论文部分内容阅读
Abstract In order to provide a scientific basis for the control of Aeromonas allosaccharophila from Procambarus clarkii， a dominant strain was isolated from moribund P. clarkii in some farm in Hubei Province， and designated X1. It was preliminarily identified to be A. allosaccharophila through physiological??biochemical test. Further sequence analysis showed that 16S rDNA of this bacterium shared 90% identity with 16S rDNA of A. allosaccharophila， suggesting that it is A. allosaccharophila. Drug sensitivity test showed that isolate X1 was sensitive to doxycycline， cefotaxime， norfloxacin and gentamicin. In animal regression test， the bacterium the same as that from naturally??diseased P. clarkii could be isolated， with the same disease symptoms as well.
Key words Procambarus clarkii； Aeromonas allosaccharophila； 16s rDNA； Drug sensitivity test
Aeromonas allosaccharophila is a kind of Gram??negative bacterium， which widely exists in water， soil， vegetable and aquatic organism in nature[1-5]. Among the bacterial diseases of fishes， Aeromonas is one of the main pathogenic bacteria， and the infection of it would cause serious loss in aquaculture production. However， few studies have been conducted on the damage of A. allosaccharophila to aquatic animals. Liu et al.[6] reported that the bacterium is the pathogen causing swollen mouth disease of Acipenser schrenckii. Yang[7] isolated A. allosaccharophila from cultured eels， and challenge test further demonstrated that the bacterium could cause an eel death rate of 100%. Zepeda??Velazquez et al.[4] reported that the bacterium could infect the liver of O. mykiss， but would not cause its death. Chenia et al.[8] found that even under dystrophic conditions， A. allosaccharophila also has stronger biofilm formation ability， which endows the bacterium with the potential of infecting fish body. Currently， there have been no reports on the isolation of A. allosaccharophila from Procambarus clarkii. In this study， a dominant strain was isolated from the hepatopancreas of diseased P. clarkii from some P. clarkii farm in Jiangxia District， Wuhan City， and the isolate was identified to be A. allosaccharophila through morphological observation， biochemical test and 16S rDNA gene sequencing. In animal regression test， the bacterium the same as that from naturally??diseased P. clarkii could be isolated， with the same disease symptoms as well. This study would provide a scientific basis for the control of A. allosaccharophila in P. clarkii culture. Material and Methods
Source of P. clarkii
Diseased P. clarkii was obtained from some P. clarkii farm in Jiangxia District， Hubei Province in April， 2017. The individuals had a body weight of about 20 g and a body length of about 7 cm. They mainly had low activity and acted slowly， and during dissection， more tissue fluid flowed out from carapace. The hepatopancreas of diseased shrimp was collected under a sterile condition for the isolation and culture of pathogenic bacteria in laboratory.
Thirty healthy individuals with an average body weight of 20-25 g were also obtained from the same farm.
Experimental materials
Tryptose soya agar （TSA） and tryptic soy broth （TSB） were both purchased from QingDao Hopebio??Technology Co.， Ltd. 10??Buffer， dNTP， Taq DNA polymerase， gel extraction kit， pMD18??T vector and Escherichia coli DH5?? competent cells were all purchased from Takara Biotechnology （Dalian） Co.， Ltd. All the chemical reagents were chemically pure. Related primers were synthesized by Sangon Biotech （Shanghai） Co.， Ltd.， and sequencing of nucleotide sequences was performed by Tianyi Huiyuan Biotechnology Co.， Ltd.
Isolation and purification of pathogenic bacteria
Hepatopancreas tissues of diseased P. clarkii were collected in a sterile condition. The material was coasted on TSA medium and cultured at 37 ?? for 18-24 h. The morphology of colonies was observed， and single colonies were picked and subjected to Gram staining and microscopic examination. Bacteria with the same morphology were cultured in TSB liquid medium for multiplication， and the obtained isolate with uniform morphology was designated X1.
Biochemical test
The obtained isolate was firstly subjected to Gram staining， and then to dextrose fermentation test （O/F test） and oxidase test. Then， the identification was performed using fermentation type Gram??negative bacillus biochemical identification kit produced by Hanzhou Microbial Reagent Co.， Ltd.， according to instruction of the kit.
Analysis of 16S rRNA gene sequence
Bacterial DNA was extracted by CTAB method. The extracted bacterial DNA was verified by nucleic acid electrophoresis and preserved in a refrigerator at -20 ??.
The amplification primers used， 16S??F： AGAGTTTGATCCTGGCTCAG and 16S??R： GGTTACCTTGTTACGACTT. The reaction system had a total volume of 25 ??l， including DNA template 0.5 ??l， forward and reverse primers 1 ??l each， 10??Buffer 2.5 ??l， dNTP 2.5 ??l， Taq DNA polymerase 0.2 ??l， and deionized water 17.3 ??l. The amplification of 16S rDNA gene was started at 94 ?? for 5 min， followed by 34 cycles of 94 ?? for 1 min， 50 ?? for 1 min and 72 ?? for 1 min， and completed by extension at 72 ?? for 10 min. The PCR product was detected by agarose gel electrophoresis. The target fragment was recovered and subjected to T vector cloning， and the recombinant plasmid was then subjected to sequencing. The sequencing result was analyzed online on NCBI after alignment and splicing.
Drug sensitivity test
Antibacterial tests were carried out on isolate X1 using 18 common antibiotics. The 18 common antibiotics included doxycycline， cefotaxime， azithromycin， chloramphenicol， sulfamethoxazole compound， norfloxacin， gentamicin， levofloxacin， amoxicillin， tetracycline， kanamycin， polymyxin B， tobramycin， erythrocin， macrodantin， vancomycin， streptomycin， novobiocin and rifampicin.
Animal regression experiment
Isolate X1 was inoculated onto TSA plates under a sterile condition and cultured at 37 ?? overnight. Single colonies were picked and inoculated to TSB liquid medium， and cultured at 37 ?? under 180 r/min to stable phase （18-24 h）. The bacterial suspension was centrifuged， and the supernatant was discarded. The precipitate was diluted with sterile normal saline by 10 times and coated onto TSA medium for plate count. The suspension concentration was calculated to be 5.0??108 cfu/ml. Then， a bacterial suspension was prepared with sterile PBS buffer.
Thirty healthy P. clarkii individuals were divided to two groups： group A， the control group， and the group B， the experimental group. Into the experimental group， 1.0??108 cfu/ml isolate X1 was added to infect the shrimp by soaking. To ensure accordant environment in the experimental group and control group， the shrimp was observed for 3 d continuously， and dead P. clarkii was dissected timely to isolate and identify the pathogens.
Results
Purification and isolation of pathogenic bacteria
A circular white dominant strain was obtained from TSA medium. It had smooth wet surface and identified to be a Gram??negative bacterium
Biochemical test
Fermentation test showed that the bacterium is a kind of fermentation type bacterium. Biochemical identification of this bacterium was performed with the fermentation type Gram??negative bacillus biochemical identification kit， and the results are shown in Table 1. Its numbering was 23475， and the bacterium was preliminarily identified as A. allosaccharophila. 16S rDNA sequence analysis
The DNA of isolate X1 was extracted with kit. With the extracted DNA as a template， specific 16S rDNA amplification was performed. The PCR product was detected through 1% agarose gel electrophoresis. The obtained target fragment was about 1 500 bp （as shown in Fig. 1）. The sequence was subjected to Blast alignment， and the results showed that the sequence shared 90% identity with 16S rDNA of A. allosaccharophila. According to above similarity alignment results， combined with physiological??biochemical characteristics， the strain was identified as A. allosaccharophila.
Drug sensitivity test
It could be seen from Table 2 that isolate X1 was sensitive to doxycycline， cefotaxime， norfloxacin and gentamicin， resistant to sulfamethoxazole compound， amoxicillin and erythrocin， and intermediately sensitive to azithromycin， tetracycline and macrodantin.
Animal regression experiment
The P. clarkii individuals in the experimental group were inoculated with A. allosaccharophila X1 by soaking method. They acted slowly 12 h later； some of them died after 36 h； and all the individuals died within 72 h， showing a lethality rate of 100%. During the dissection of the P. clarkii individuals in the experimental group， more tissue flowed out from the carapace， and the bacteria with the morphological characteristics and biochemical properties the same as isolate X1 were isolated from the hepatopancreatic tissue. However， this bacterium was not isolated from the individual in the control group.
Discussion
In recent years， with the expansion of P. clarkii farming， the disease problem has been increasingly prominent. The bacterial pathogens reported currently mainly include A. hydrophila， Vibrio parahaemolyticus， Citrobacter freundii and Aeromonas veronii[9-12]. In this study， an A. allosaccharophila strain was isolated from the hepatopancreatic tissue of P. clarkii naturally diseased. This isolate could infect and cause the death of P. clarkii. A. allosaccharophila serves as a kind of conditioned pathogen widely existing in natural water body， even in various sludge[2]， which could infect the livers of sea eel， A. schrencki and O. mykiss[4， 6-7]. Under deteriorated farming environment， it is very likely to infect P. clarkii. Because P. clarkii lacks specific immunity， it is reasonable for A. allosaccharophila to infect its hepatopancreas and cause its death. The aquatic water sampled in this study is seriously deteriorated due to improper management， and provides the environment for the infection with A. allosaccharophila objectively. Plus the stress state of P. clarkii， the infection was thus caused. The drug sensitivity test showed that chloramphenicol， levofloxacin and rifampicin have a very strong inhibitory effect on A. allosaccharophila， which also provides a new idea for the control of this disease. Agricultural Biotechnology 2018References
[1] LATIF??EUGENIN F， BEAZ??HIDALGO R， SILVERA??SIMON C， et al. Chlorinated and ultraviolet radiation??treated reclaimed irrigation water is the source of Aeromonas found in vegetables used for human consumption[J]. Environmental research， 2017， 154： 190-195.
[2] TCHUINTE P L S， STALDER T， VENDITTI S， et al. Characterisation of class 3 integrons with oxacillinase gene cassettes in hospital sewage and sludge samples from France and Luxembourg[J]. International journal of antimicrobial agents， 2016， 48（4）： 431-434.
[3] MARTINEZ??MURCIA AJ， ESTEVE C， GARAY E， et al. Aeromonas allosaccharophila sp. nov.， a new mesophilic member of the genus Aeromonas[J]. FEMS microbiology letters， 1992， 70（3）： 199-205.
[4] ZEPEDA??VELAZQUEZ AP， VEGA??SANCHEZ V， ORTEGA??SANTANA C， et al. Pathogenicity of Mexican isolates of Aeromonas sp. in immersion experimentally??infected rainbow trout （Oncorhynchus mykiss， Walbaum 1792）[J]. Acta tropica， 2017， 169：122-124.
[5] PICAO RC， POIREL L， DEMARTA A， et al. Plasmid??mediated quinolone resistance in Aeromonas allosaccharophila recovered from a Swiss lake[J]. The Journal of antimicrobial chemotherapy， 2008， 62： 948-950.
[6] LIU SF， ZOU ZY， YUAN MY， et al. Diagnose and control of swollen mouth disease in Acipenser schrenckii[J]. Scientific Fish Farming， 2015， 31（1）： 57-58.
[7] YANG QH. Isolation and identification of the pathogenic Aeromonas spp. from farmed eels[D]. Xiamen： Jimei University ， 2012.
[8] CHENIA HY， DUMA S. Characterization of virulence， cell surface characteristics and biofilm??forming ability of Aeromonas spp. isolates from fish and sea water[J]. Journal of fish diseases， 2017， 40： 339-350.
[9] JIANG GM， QIAN CY， GU XL， et al. The etiological agents of bacterial septicemia in Eriocheir sinensis and Procambarus clarkia[J]. Journal of Aquaculture， 2016， 37（4）： 46-51.
[10] LIU XM， ZHAO YQ， CHEN J. Advances in diseases and control Procambarus clarkii diseases and control technique[J]. China Fisheries， 2013， （10）： 64-66.
[11] MA XR， XUE H， TANG JQ. Isolation and identification and drug sensitivity test of pathogenic Aeromonas allosaccharophila in Procambarus clarkii[J]. Journal of Aquaculture， 2012（8）： 45-47.
[12] CHEN CF， LIU YG， HE GW， et al. The bacterial pathogen of outbreak disease in Procambarus clarkii[J]. Journal of Huazhong Agricultural University， 2009， 28（2）： 193-197.
Key words Procambarus clarkii； Aeromonas allosaccharophila； 16s rDNA； Drug sensitivity test
Aeromonas allosaccharophila is a kind of Gram??negative bacterium， which widely exists in water， soil， vegetable and aquatic organism in nature[1-5]. Among the bacterial diseases of fishes， Aeromonas is one of the main pathogenic bacteria， and the infection of it would cause serious loss in aquaculture production. However， few studies have been conducted on the damage of A. allosaccharophila to aquatic animals. Liu et al.[6] reported that the bacterium is the pathogen causing swollen mouth disease of Acipenser schrenckii. Yang[7] isolated A. allosaccharophila from cultured eels， and challenge test further demonstrated that the bacterium could cause an eel death rate of 100%. Zepeda??Velazquez et al.[4] reported that the bacterium could infect the liver of O. mykiss， but would not cause its death. Chenia et al.[8] found that even under dystrophic conditions， A. allosaccharophila also has stronger biofilm formation ability， which endows the bacterium with the potential of infecting fish body. Currently， there have been no reports on the isolation of A. allosaccharophila from Procambarus clarkii. In this study， a dominant strain was isolated from the hepatopancreas of diseased P. clarkii from some P. clarkii farm in Jiangxia District， Wuhan City， and the isolate was identified to be A. allosaccharophila through morphological observation， biochemical test and 16S rDNA gene sequencing. In animal regression test， the bacterium the same as that from naturally??diseased P. clarkii could be isolated， with the same disease symptoms as well. This study would provide a scientific basis for the control of A. allosaccharophila in P. clarkii culture. Material and Methods
Source of P. clarkii
Diseased P. clarkii was obtained from some P. clarkii farm in Jiangxia District， Hubei Province in April， 2017. The individuals had a body weight of about 20 g and a body length of about 7 cm. They mainly had low activity and acted slowly， and during dissection， more tissue fluid flowed out from carapace. The hepatopancreas of diseased shrimp was collected under a sterile condition for the isolation and culture of pathogenic bacteria in laboratory.
Thirty healthy individuals with an average body weight of 20-25 g were also obtained from the same farm.
Experimental materials
Tryptose soya agar （TSA） and tryptic soy broth （TSB） were both purchased from QingDao Hopebio??Technology Co.， Ltd. 10??Buffer， dNTP， Taq DNA polymerase， gel extraction kit， pMD18??T vector and Escherichia coli DH5?? competent cells were all purchased from Takara Biotechnology （Dalian） Co.， Ltd. All the chemical reagents were chemically pure. Related primers were synthesized by Sangon Biotech （Shanghai） Co.， Ltd.， and sequencing of nucleotide sequences was performed by Tianyi Huiyuan Biotechnology Co.， Ltd.
Isolation and purification of pathogenic bacteria
Hepatopancreas tissues of diseased P. clarkii were collected in a sterile condition. The material was coasted on TSA medium and cultured at 37 ?? for 18-24 h. The morphology of colonies was observed， and single colonies were picked and subjected to Gram staining and microscopic examination. Bacteria with the same morphology were cultured in TSB liquid medium for multiplication， and the obtained isolate with uniform morphology was designated X1.
Biochemical test
The obtained isolate was firstly subjected to Gram staining， and then to dextrose fermentation test （O/F test） and oxidase test. Then， the identification was performed using fermentation type Gram??negative bacillus biochemical identification kit produced by Hanzhou Microbial Reagent Co.， Ltd.， according to instruction of the kit.
Analysis of 16S rRNA gene sequence
Bacterial DNA was extracted by CTAB method. The extracted bacterial DNA was verified by nucleic acid electrophoresis and preserved in a refrigerator at -20 ??.
The amplification primers used， 16S??F： AGAGTTTGATCCTGGCTCAG and 16S??R： GGTTACCTTGTTACGACTT. The reaction system had a total volume of 25 ??l， including DNA template 0.5 ??l， forward and reverse primers 1 ??l each， 10??Buffer 2.5 ??l， dNTP 2.5 ??l， Taq DNA polymerase 0.2 ??l， and deionized water 17.3 ??l. The amplification of 16S rDNA gene was started at 94 ?? for 5 min， followed by 34 cycles of 94 ?? for 1 min， 50 ?? for 1 min and 72 ?? for 1 min， and completed by extension at 72 ?? for 10 min. The PCR product was detected by agarose gel electrophoresis. The target fragment was recovered and subjected to T vector cloning， and the recombinant plasmid was then subjected to sequencing. The sequencing result was analyzed online on NCBI after alignment and splicing.
Drug sensitivity test
Antibacterial tests were carried out on isolate X1 using 18 common antibiotics. The 18 common antibiotics included doxycycline， cefotaxime， azithromycin， chloramphenicol， sulfamethoxazole compound， norfloxacin， gentamicin， levofloxacin， amoxicillin， tetracycline， kanamycin， polymyxin B， tobramycin， erythrocin， macrodantin， vancomycin， streptomycin， novobiocin and rifampicin.
Animal regression experiment
Isolate X1 was inoculated onto TSA plates under a sterile condition and cultured at 37 ?? overnight. Single colonies were picked and inoculated to TSB liquid medium， and cultured at 37 ?? under 180 r/min to stable phase （18-24 h）. The bacterial suspension was centrifuged， and the supernatant was discarded. The precipitate was diluted with sterile normal saline by 10 times and coated onto TSA medium for plate count. The suspension concentration was calculated to be 5.0??108 cfu/ml. Then， a bacterial suspension was prepared with sterile PBS buffer.
Thirty healthy P. clarkii individuals were divided to two groups： group A， the control group， and the group B， the experimental group. Into the experimental group， 1.0??108 cfu/ml isolate X1 was added to infect the shrimp by soaking. To ensure accordant environment in the experimental group and control group， the shrimp was observed for 3 d continuously， and dead P. clarkii was dissected timely to isolate and identify the pathogens.
Results
Purification and isolation of pathogenic bacteria
A circular white dominant strain was obtained from TSA medium. It had smooth wet surface and identified to be a Gram??negative bacterium
Biochemical test
Fermentation test showed that the bacterium is a kind of fermentation type bacterium. Biochemical identification of this bacterium was performed with the fermentation type Gram??negative bacillus biochemical identification kit， and the results are shown in Table 1. Its numbering was 23475， and the bacterium was preliminarily identified as A. allosaccharophila. 16S rDNA sequence analysis
The DNA of isolate X1 was extracted with kit. With the extracted DNA as a template， specific 16S rDNA amplification was performed. The PCR product was detected through 1% agarose gel electrophoresis. The obtained target fragment was about 1 500 bp （as shown in Fig. 1）. The sequence was subjected to Blast alignment， and the results showed that the sequence shared 90% identity with 16S rDNA of A. allosaccharophila. According to above similarity alignment results， combined with physiological??biochemical characteristics， the strain was identified as A. allosaccharophila.
Drug sensitivity test
It could be seen from Table 2 that isolate X1 was sensitive to doxycycline， cefotaxime， norfloxacin and gentamicin， resistant to sulfamethoxazole compound， amoxicillin and erythrocin， and intermediately sensitive to azithromycin， tetracycline and macrodantin.
Animal regression experiment
The P. clarkii individuals in the experimental group were inoculated with A. allosaccharophila X1 by soaking method. They acted slowly 12 h later； some of them died after 36 h； and all the individuals died within 72 h， showing a lethality rate of 100%. During the dissection of the P. clarkii individuals in the experimental group， more tissue flowed out from the carapace， and the bacteria with the morphological characteristics and biochemical properties the same as isolate X1 were isolated from the hepatopancreatic tissue. However， this bacterium was not isolated from the individual in the control group.
Discussion
In recent years， with the expansion of P. clarkii farming， the disease problem has been increasingly prominent. The bacterial pathogens reported currently mainly include A. hydrophila， Vibrio parahaemolyticus， Citrobacter freundii and Aeromonas veronii[9-12]. In this study， an A. allosaccharophila strain was isolated from the hepatopancreatic tissue of P. clarkii naturally diseased. This isolate could infect and cause the death of P. clarkii. A. allosaccharophila serves as a kind of conditioned pathogen widely existing in natural water body， even in various sludge[2]， which could infect the livers of sea eel， A. schrencki and O. mykiss[4， 6-7]. Under deteriorated farming environment， it is very likely to infect P. clarkii. Because P. clarkii lacks specific immunity， it is reasonable for A. allosaccharophila to infect its hepatopancreas and cause its death. The aquatic water sampled in this study is seriously deteriorated due to improper management， and provides the environment for the infection with A. allosaccharophila objectively. Plus the stress state of P. clarkii， the infection was thus caused. The drug sensitivity test showed that chloramphenicol， levofloxacin and rifampicin have a very strong inhibitory effect on A. allosaccharophila， which also provides a new idea for the control of this disease. Agricultural Biotechnology 2018References
[1] LATIF??EUGENIN F， BEAZ??HIDALGO R， SILVERA??SIMON C， et al. Chlorinated and ultraviolet radiation??treated reclaimed irrigation water is the source of Aeromonas found in vegetables used for human consumption[J]. Environmental research， 2017， 154： 190-195.
[2] TCHUINTE P L S， STALDER T， VENDITTI S， et al. Characterisation of class 3 integrons with oxacillinase gene cassettes in hospital sewage and sludge samples from France and Luxembourg[J]. International journal of antimicrobial agents， 2016， 48（4）： 431-434.
[3] MARTINEZ??MURCIA AJ， ESTEVE C， GARAY E， et al. Aeromonas allosaccharophila sp. nov.， a new mesophilic member of the genus Aeromonas[J]. FEMS microbiology letters， 1992， 70（3）： 199-205.
[4] ZEPEDA??VELAZQUEZ AP， VEGA??SANCHEZ V， ORTEGA??SANTANA C， et al. Pathogenicity of Mexican isolates of Aeromonas sp. in immersion experimentally??infected rainbow trout （Oncorhynchus mykiss， Walbaum 1792）[J]. Acta tropica， 2017， 169：122-124.
[5] PICAO RC， POIREL L， DEMARTA A， et al. Plasmid??mediated quinolone resistance in Aeromonas allosaccharophila recovered from a Swiss lake[J]. The Journal of antimicrobial chemotherapy， 2008， 62： 948-950.
[6] LIU SF， ZOU ZY， YUAN MY， et al. Diagnose and control of swollen mouth disease in Acipenser schrenckii[J]. Scientific Fish Farming， 2015， 31（1）： 57-58.
[7] YANG QH. Isolation and identification of the pathogenic Aeromonas spp. from farmed eels[D]. Xiamen： Jimei University ， 2012.
[8] CHENIA HY， DUMA S. Characterization of virulence， cell surface characteristics and biofilm??forming ability of Aeromonas spp. isolates from fish and sea water[J]. Journal of fish diseases， 2017， 40： 339-350.
[9] JIANG GM， QIAN CY， GU XL， et al. The etiological agents of bacterial septicemia in Eriocheir sinensis and Procambarus clarkia[J]. Journal of Aquaculture， 2016， 37（4）： 46-51.
[10] LIU XM， ZHAO YQ， CHEN J. Advances in diseases and control Procambarus clarkii diseases and control technique[J]. China Fisheries， 2013， （10）： 64-66.
[11] MA XR， XUE H， TANG JQ. Isolation and identification and drug sensitivity test of pathogenic Aeromonas allosaccharophila in Procambarus clarkii[J]. Journal of Aquaculture， 2012（8）： 45-47.
[12] CHEN CF， LIU YG， HE GW， et al. The bacterial pathogen of outbreak disease in Procambarus clarkii[J]. Journal of Huazhong Agricultural University， 2009， 28（2）： 193-197.