Abstract In this study， Hy322 gene was cloned from Vibrio alginolyticus. The total length of its gene was 969 bp， and it could encode 322 amino acids. The physicochemical properties， protein structure， genetic evolutionary relationship and antigenic characteristics of the effector protein Hy322 of V. alginolyticus HY9901 type III secretion system were studied and analyzed by bioinformatics methods and tools. The results showed that Hy322 is an unstable hydrophilic and acidic protein without a transmembrane region and a signal peptide， and secondary structure to αhelix. The evolutionary analysis showed that V. alginolyticus HY9901 and V. harveyi were clustered together， which indicated that the genetic relationship between the two species was closest. HY322 contains a FliN super family conserved domain associated with Flagellar motor switch. Bioinformatics analysis showed that the Bcell preponderant epitopes of Hy322 might be localized in the regions of 32-33， 100-102， 138-140， 215-216， 235-238 and 246-249. The 3D structure model of Hy322 subunit was simulated by SWISSMODEL software and itwas found that the yscQ of Yersinia were similar and the similarity was 42.25%. In this study， the feasibility of Hy322 as a common antigen of Vibrio was verified from the perspective of bioinformatics， which laid the foundation for the next step in vaccine development.
　　Key words Vibrio alginolyticus; Type III secretory system; Effector protein; Bioinformatics analysis
　　Received： October 23， 2017  Accepted： December 28， 2017
　　Supported by Shenzhen Science and Technology Project （JCYJ20170818111629778， JCYJ20170306161613251）; National Natural Science Foundation of Guangdong Province （2017A030313174）; Natural Science Foundation of Guangdong Ocean University （C17379）; Undergraduate Innovative and Entrepreneurial Team Project （CCTD201802）.
　　*Cofirst authors：  Shanshan LIANG （1997-）， female， P. R. China， a college student majoring in diseases controlling for aquatic economic animals， Email： 1399213983@qq.com; Mingjie FAN （1999-）， male， P. R. China， a college student majoring in diseases controlling for aquatic economic animals，  Email： 1457293921@qq.com.
　　**Cocorresponding authors： Huanying PANG （1980- ）， female， P. R. China， associate professor， PhD， devoted to research about aquatic animal diseases， Email： phying1218@163.com; Chuanhao PAN （1976-）， male， P. R. China， devoted to research about aquatic animal， Email：229528377@qq.com. 　　Vibrioalginolyticus is a kind of common marine conditioned pathogen， and known to be one of the main pathogens causing vibriosis in aquatic animals， including shellfish[1]， shrimp[2]and coral reef[3]. Meanwhile， V. alginolyticus also would cause death of Pseudosciaena crocea in a large area， resulting in severe economic loss of aquaculture industry.
　　Type III secretion system （T3SS） has been ascertained to be a virulent element in the shape of a needle conservatively existing in bacteria， which activates the secretory pathway depending on the contact with host cells and infuses type III secreted system effector proteins （T3SEs） to host cells， thereby affecting normal metabolism and function of host cells and causing cytoskeleton and immune dysfunction of host cells， which further induce the death of host cellS[3-4].T3SS has become one of the research hotspots on pathogens in recent years. The research team of this study has done indepth studies on V. alginolyticus Type III secretion system molecular chaperone and injectisome protein[5a-5b]， laying a foundation for the study on other proteins of V. alginolyticus Type III secretion system.
　　In the preliminary study， the research team obtained the Type III secretion system effector protein HY322， and its full length （GenBank： KX245317.1） was obtained through further sequencing and sequence alignment. In this study， in order to further study its biological function， the protein sequence of HY322 was systematically predicted and studied by bioinformatics methods and tools.
　　Matarials and Methods
　　Materials
　　Complete amino acid sequence of HY9901 V. alginolyticus effector protein HY322 （GenBank： KX245317.1）， committed by the laboratory， serving as the object of study; Escherichia coli  DH5α， provided by the laboratory; cloning vector pMD18T Vector， purchased from TaKaRa （Dalian）; Easy Taq and Ex Taq， purchased from Transgen Biotech; PCR amplifier， purchased from BioRad company; UNIQ10 column type bacterial genomic Ezup Column Bacteria Genomic DNA Purification Kit.
　　Extraction of total DNA of V. alginolyticus
　　Single colonies of V. alginolyticus were cultured with TSB medium， and subjected to DNA extraction according to the instruction of DNA purification kit.
　　Amplification of V. alginolyticus Va1686 gene fragment
　　The sequence fragment encoded by HY322 gene was amplified using following primers： forward primer V1： 5′ATGACGCCGTTAATAATCCCCA3′， and reverse primer V2： 5′TCA TGCTGGCTCCTGCGTGC3′. The PCR program was started with 94 ℃ for 5 min， followed by 35 cycles of 94 ℃ for 45 s， 55 ℃ for 45 s and 72 ℃ for 90 s， and fully extended at 72 ℃ for 10 min， and the product was preserved at 4 ℃. Then， the PCR product was subjected to electrophoresis detection， recovery of target band， ligation with pMD 18T Vector， and transformation of ligation product. The selected clones were subjected to PCR identification， and positive clones were selected for sequencing （Sangon Biotech （Guangzhou） Co.， Ltd.）. 　　MethodsThe physicochemical properties of V. alginolyticus HY322 protein were analyzed using ExPASy software with reference to literature[6]. The Nterminal signial peptide sequence of HY322 protein was predicted using SignalP 4.1 Server software. Transmembrane domains were predicted using TMHMM Server 2.0 software. Subcellular localization was performed using PSORT. The potential phosphorylation sites and glycosylation sites were predicted using SoftBerryPsite software. The amino acid sequences of other Vibrio strains similar to the studied protein were searched in NCBI using the provided BLAST online searching software. These amino acid sequences were analyzed using MEGA6.0 software by neighborjoining method （NJ）. Multiple sequence analysis of amino acids were performed using ClustalX2 software， so as to deduce the evolutionary relationship of this protein with different strains. The secondary structure of HY322 was predicted by ChouFasman method， and the hydrophilic parameter of HY322 was predicted by KyteDoolittle method; the flexibility parameter was predicted by KarplusSchulz method; the surface probability parameter of Va1686 was predicted by Emini method; and the antigenicity parameter of HY322 was predicted by JamesonWolf method. The results of the various parameters were compared， and finally， the Bcell preponderant epitopes of V. alginolyticus HY9901 HY322 protein were determined using DNAstar software according to the various parameters comprehensively. Homologous modeling of V. alginolyticus HY322 protein was performed using SWISSMODEL software， to predict its 3D structure.
　　Results and Analysis
　　Cloning of Va1686 gene
　　Through PCR amplification， a specific band at about 969 bp was obtained （Fig. 1）. The product was ligated with the cloning vector pMD18T， and the ligation product was sequenced by sequencing company. The HY322 gene contains a 969 bp open reading frame （ORF）， and could encode 387 amino acids. The gene was submitted to GenBank， with an accession number of KX245317.1.
　　Physicochemical properties and sequence analysis
　　The physicochemical properties of V. alginolyticus HY322 protein （Table 1） was analyzed using ExPASy （http：//web.expasy.org/protparam/） software. The molecular structural formula of HY322 is C1798H2874N520O580S13， with a total atom number of 5 785. HY322 is an unstable hydrophilic protein with a theoretical pI value of 4.79. The protein is acidic without pyrrolysine and selenocysteine. 　　Table 1 Physicochemical properties of HY322protien
　　Protein NameMolecularmass∥kuTheoretical pIInstabilityindexGrand averageof hydropathicyNumber of negativelycharged residues （Asp+Glu）Number of positivelycharged residues （Arg + Lys）
　　HY32235.614.7940.48-0.0543416
　　The HY322 protein was subjected to signal peptide prediction using SignalP 4.1 Server （http：//www.cbs.dtu.dk/services/SignalP/） online software， and the results showed that the protein contains no significant signal peptide cleavage sites. PORST（https：//psort.hgc.jp/） subcellular localization prediction showed that HY322 exists in cytoplasm. The prediction using TMHMM Server 2.0 （http：//www.cbs.dtu.dk/services/TMHMM2.0/） online software showed that HY322 contains no transmembrane domain. The prediction using SoftBerryPsite （http：//linux1.softberry.com/berry.phtml topic=psite&group=programs & subgroup=proloc） online software showed that the amino acid sequence of HY322 potentially contains three casein kinase II phosphorylation sites， one protein kinase C phosphorylation site， three Nglycosylation sites， one Nmyristoylation site and four microbodies Cterminal targeting signal sites （Fig. 2）.
　　Homology analysis with similar protein sequences of other Vibrio strains
　　The HY322 protein sequence of V. alginolyticus was subjected to homology comparison with other Vibrio trains including V. harveyi and V. parahaemolyticus through Blast （http：//blast.ncbi.nlm.nih.Gov/Blast.cgi）. The results showed that HY322 protein is relatively stable in Vibrio（Fig. 3）. A phylogenetic tree was built with HY322 protein sequence of V. alginolyticus HY9901 and similar protein sequences of other Vibrio strains using MEGA 6.0 system software， and the results showed that V. alginolyticus HY9901 and （V. harveyi） were clustered together， indicating that the genetic relationship between the two species was closest （Fig. 3）.
　　The terminator is showed by an asterisk; the protein kinase C phosphorylation site are shadowed; the casein kinase II phosphorylation site are in the box; " " stands for the Nmyristoylation site; "" stands for the microbodies Cterminal targeting signal; "" stands for the Nglycosylation site.
　　Shanshan LIANG et al. Molecular Cloning and Bioinformatics Analysis of Type III Secretion System Effector Protein HY322 Gene of Vibrio alginolyticus
　　Prediction of function domains and higher structure of HY322
　　The amino acid sequence of HY322 protein was committed to NCBI online conserved domain database CDD （http：//www.ncbi.nlm.nih.gov/Structure/Lexington/lexington.cgi） to be analyzed， and the results showed that HY322 contains a FliN super family conserved domain in the region of 1320 （Fig. 5）. The secondary structure of HY322 was predicted using  SOPMA （https：//npsaprabi.ibcp. fr/cgibin/npsa_automat.pl？page=/NPSA/npsa_sopma.html） online software， and the results showed that in the secondary structure of HY322， alpha helix accounts for 33.23%， random coil accounts for 27.64%， extended strand accounts for 26.40%， and betasheet accounts for 12.73% （Fig. 6）. 　　Prediction of the Bcell preponderant epitopes of HY322
　　According to ChouFasman method， the secondary structure of HY322 was mainly αhelix and βsheet， which were mainly distributed in the regions of 18-21， 31-34， 86-89， 95-98， 100-103， 138-141， 148-151， 158-161 and 199-202， and 214-217， 235-238， 240-243， 246-249， 273-276， 291-294， 304-307 and 317-320， as shown in 7A. Generally， there are abundant turn structures between αhelix and βsheet. Because turn structure is loose， these regions would be bound with antibodies easily， thereby forming epitopes easily.
　　The hydrophilcity of HY322 was analyzed by KyteDoolittle method. As shown in Fig. 7B， the hydrophilic regions of HY322 were located in the ranges of 22-36， 61-77， 98-105， 121-131， 137-142 and 182-190， and 201-252， 264-279， 282-291 and 318-322.
　　 The flexibility of HY322 was predicted according to KarplusSchulz method. The flexible regions were located in the regions of 10-13， 19-21， 30-37， 45-48， 56-61， 75-78， 85-89， 98-104， 118-129 and 137-142， and 148-153， 158-161， 178-180， 204-208， 213-216， 223-226， 232-249， 268-274， 281-288， 292-295 and 318-321 （Fig. 7C）. The structure of a protein depends on its flexibility to a certain degree， and the larger the flexibility， the easier the regions with higher flexibility distort， which is beneficial to the chimerism with antibodies.
　　The antigenicity index of HY322 was predicted by JamesonWolf method， and there were more regions： 30-36， 48-51， 64-67， 85-89， 96-106 and 120-129， and 136-142， 147-154， 200-208， 213-218， 221-226， 229-249， 280-298 and 317-322， which have higher antigenicity index（Fig. 7D）.
　　 The surface probability of HY322 was predicted by Emini method. The results showed that there were10 regions in total： 98-102， 125-130， 136-140， 204-208， 223-225， 230-240， 244-251， 267-273， 283-284 and 320-322（Fig. 7E）.
　　Using DNAStar software， the secondary structure， hydrophilcity， flexibility， antigenicity index and surface probability were comprehensively analyzed， and the characteristics of 6 regions satisfied requirements to all above indices： 32-33， 100-102， 138-140， 215-216， 235-238 and 246-249. These 6 regions had higher comprehensive indices， and could be deduced to contain potential Bcell preponderant epitopes.
　　Prediction of tertiary structure
　　Homologous modeling of V. alginolyticus HY9901 HY322 protein was performed using SWISSMODEL （http：//swissmodel. expasy.org/） online software， obtaining the 3D structure model of HY322 protein subunit （Fig. 8）. The results showed that the similarity with its homologous protein yscQ of Yersinia was 42.25%[7] . 　　Disucssion
　　Type III secreted system effector proteins are important executors of bacterial virulence， as well as the key of the interaction between pathogens and hosts. With the HY322 protein sequence committed to NCBI by the research team of this study as the object of study， it was found by bioinformatics analysis that HY322 protein belongs to soluble protein without a transmembrane domain and an obvious signal peptide， which satisfies the characteristic that this type of proteins enter hosts to play their role with the need for the help of molecular chaperones， which coincides with the prediction result of subcellular localization. The secondary structure of HY322 protein satisfies the "α+β" folding pattern[8]. This amino acid sequence contains three casein kinase II phosphorylation site， one protein kinase C phosphorylation sites， three Nglycosylation site， one Nmyristoylation sites and four microbodies Cterminal targeting signal sites. Phosphorylation is a kind of biological modification after the protein translation[9-10]， which could improve the specificity of proteins. Because V. alginolyticus contains no Golgi apparatus and endoplasmic reticulum for deep processing of proteins after translation， it could not perform modification such as amidation or glycosylation after translation. However， phosphorylation is not influenced[11]， and in future studies， mutant strains with the deletion of phosphorylation sites could be constructed to further perform indepth function analysis of HY322.
　　Through the alignment of protein sequences of various Vibrio strains， it was found that the HY322 protein in Vibrio was highly similar， indicating that the protein is relatively stable in the evolutionary process of Vibrio. On the built phylogenetic tree， V. alginolyticus HY9901 was clustered together with V. harveyi， indicating that the genetic relationship between the two species was closest， which also satisfies the results of morphological and biochemical classification. Comprehensively from the prediction of Bcell preponderant epitopes and the alignment of amino acid sequences， it was speculated that HY322 protein might be the common antigen of Vibrio， and plays an important role in the pathogenicprocesses of Vibrio.
　　Further analysis showed that the secondary structure of HY322 protein is furthered folded， forming a FliN conserved domain between the secondary structure and 3D structure. According to literatures at abroad[12-13]， FliN protein constitutes the starting switch of flagella together with other two proteins FliG and FliM in salmonella， so it plays an important role in the formation of flagella and is closely correlated with the movement and adhesion of bacteria. Adhesion is an important pathogenic factor for V. alginolyticus， and in the infection process of conditioned pathogen， adhesion plays an important role[14]. The adhesion of V. alginolyticus is affected by its swimming motility， and the faster it swims， the higher the adhesion efficiency[15]. Furthermore， the study of Bzymek on Yersinia[7] shows that the homologous protein YscQ of FliM could translate the homologous protein YscQC of FliN， and YscQ and YscQC are essential constituent parts of type III  secretion system. Therefore， the directional deletion of the gene encoding related flagellin could further make its specific role in the pathogenic process of V. alginolyticus clear. 　　In this study， the type III secreted system effector proteinHY322 of V. alginolyticus was subjected to bioinformatics analysis， and the secondary structure， 3D structure， conserved domains and Bcell preponderant epitopes of the protein were predicted and analyzed， with an attempt to lay a foundation for the profound understanding of the action mechanism between type III secreted system effector protein and host cells. This study laid a foundation for further illumination of the action mechanism of V. alginolyticus effector protein HY322.
　　References
　　[1] HEO YJ， LEE CH， BAEK MS， et al. Morphological characterization of Vibrio alginolyticus specific bacteriophage isolated from fish farms on west coast of Korea[J]. J. Fish. Pathol.， 2012， 25： 165-172.
　　[2] AHMED R， RAFIQUZAMAN SM， HOSSAIN MT， et al. Speciesspecific detection of Vibrio alginolyticus in shellfish and shrimp by realtime pcr using the groel gene[J]. Aquaculture International， 2016， 24（1）： 1-14.
　　[3] XIE HX， YU HB， ZHENG J， et al. Eseg， an effector of the type III secretion system of Edwardsiella tarda， triggers microtubule destabilization[J]. Infection & Immunity， 2010， 78（12）： 5011.
　　[4] BURDETTE DL， SEEMANN J， ORTH K. Vibrio VopQ induces pi3kinaseindependent autophagy and antagonizes phagocytosis[J]. Molecular Microbiology， 2009， 73（4）： 639.
　　[5a] PANG HY，ZHOU ZJ，DING Y，et al. Molecular cloning and bioinformatics analysis of T3SS chaperone escort protein VscO from Vibrio alginolyticus[J]. Biotechnology Bulletin， 2014 （6）： 155-161.
　　[5b] PANG HY， ZHOU ZJ， DING Y， et al. Prokaryotic expression and immunogenicity of the type III secretion system injectisome protein VscO from Vibrio alginolyticus[J]. Journal of Guangdong Ocean University， 2014， 34（3）： 41-46.
　　[6] WILKINS MR， GASTEIGER E， BAIROCH A， et al. Protein identification and analysis tools in the expasy server[J]. Methods in Molecular Biology， 1999， 112（112）： 531-552.
　　[7] BZYMEK KP， HAMAOKA BY， GHOSH P. Two translation products of yersinia yscq assemble to form a complex essential to type III secretion[J]. Biochemistry， 2012， 51（8）：1669-77.
　　[8] Murzin AG， Brenner SE， Hubbard T， et al， SCOP： A structural classification of proteins for the investigation of sequences and structures[J]. Journal of molecular biology， 1995 （247）： 536-540.
　　[9] KIM JH， LEE J， OH B， et al. Prediction of phosphorylation sites using svms[J]. Bioinformatics， 2004， 20（17）： 3179. 　　[10] TIAN M， CHEN X， XIONG Q， et al. Phosphoproteomic analysis of protein phosphorylation networks in Tetrahymena thermophila， a model singlecelled organism[J]. Molecular & Cellular Proteomics， 2013， 13（2）： 503.
　　[11] HUNTER T. Signaling2000 and beyond[J]. Cell， 2000，100（1）： 113.
　　[12] ZHAO R， PATHAK N， JAFFE H， et al. Flin is a major structural protein of the cring in the salmonella typhimurium flagellar basal body[J]. Journal of Molecular Biology， 1996， 261（2）： 195-208.
　　[13] KHANI H， REESE TS， KHAN S. The cytoplasmic component of the bacterial flagellar motor[J]. Proceedings of the National Academy of Sciences of the United States of America， 1992， 89（13）： 5956-5960.
　　[14] SNOUSSI M， NOUMI E， HAJLAOUI H， et al. High potential of adhesion to abiotic and biotic materials in fish aquaculture facility by Vibrio alginolyticus strains[J]. Journal of Applied Microbiology， 2009， 106（5）： 1591-1599.
　　[15] KOGURE K， IKEMOTO EH. Attachment of Vibrio alginolyticus to glass surfaces is dependent on swimming speed[J]. Journal of Bacteriology，1998， 180（4）： 932.