论文部分内容阅读
AbstractCollard variety (Brassis oleracea L. var. acephala f. tricolor Hort.) as a research material was treated with exogenous H2O2 and H2O2 scavenger dimethyl thiourea under 100 mmol/L NaCl stress. Two days later, growth rate, dry weight, fresh weight and relative water content of the plants were determined. After 6 h of treatment, the activity and gene expression of three antioxidant enzymes, superoxide dismutase (SOD), catalase (CAT) and ascorbate peroxidase (APX) in plants, were measured. The results showed that the growth rate, dry weight, fresh weight, relative water content, and the activity and gene expression of the three antioxidant enzymes in collard seedlings were higher in the treatment of salt stress with the addition of 0.05 mmol/L exogenous H2O2 than in the simple salt stress treatment; and when endogenous H2O2 was removed, the growth rate, dry weight, fresh weight, relative water content, and the activity and gene expression of the three antioxidant enzymes in plant seedlings were lower than those under simple salt stress. It is speculated that under salt stress, H2O2 is involved in the regulation of antioxidant defense gene expression, and it might be an important regulator of saltinduced antioxidant system in collard leaves.
Key wordsBrassica oleracea L. var. acephala f. tricolor Hort.; H2O2; Salt stress; Antioxidase; Gene expression
Received: August 21, 2018Accepted: November 12, 2018
Supported by Science and Technology Development Planning Project of Henan Province (182102110305).
Wei LI (1988-), male, P. R. China, lecturer, master, devoted to research about landscape plants and landscape design.
*Corresponding author. Email: 357719846@qq.com.
Salt stress is the most common stress condition causing severe crop yield reduction. Improving plant resistance to environmental stress, especially resistance to salt stress, is the first target for stable plant growth. When plants are exposed to environmental stress, a large amount of active oxygen is produced, including hydrogen peroxide (H2O2), singlet oxygen (1O2), hydroxyl radical (?OH), superoxide anion (O-2?) and lipid peroxy radical (ROO?)［1-4］. Salt stress can rapidly induce the accumulation of reactive oxygen species in plants, causing oxidative damage to proteins and lipids［5］. There are two kinds of scavenging protection mechanisms in plants, namely enzymatic system and nonenzymatic system, of which the enzymatic system includes superoxide dismutase (SOD), catalase (CAT) and ascorbate peroxidase (APX). Studies have shown that salt stress can increase the activity of active oxygen in plants［6-8］. In recent years, many experiments have shown that H2O2 is a kind of important signaling molecule that can be produced by plant cells when responding to various stresses and further regulates a series of signal transduction of stress response［9-14］. There have been evidences showing that the accumulation of endogenous H2O2 can increase the stress resistance of plants under adverse conditions, and excessive ROS such as H2O2 can cause oxidative damage to macromolecules in cells. Wahid et al.［13］ showed that hydrogen peroxide pretreatment can keep cell membrane system intact, and in turn, improve the antioxidant capacity of wheat seeds and enhance the salt tolerance in wheat during germination. SOS1 (salt overly sensitive), which plays a key role in the salttolerant response of plants, is a Na+/H+ antiporter of Arabidopsis thaliana, and H2O2 can regulate the stability of its mRNA. However, under salt stress induction, the relation between H2O2 and the activity and expression mechanism of oxidases still remains to be fully understood. In this study, the effects of applying exogenous H2O2 or removing invivo H2O2 on growth characteristics, antioxidant enzyme activity and related gene expression of collard (Brassica oleracea L. var. acephala f. tricolor Hort.) seedlings under salt stress were investigated, so as to reveal the action mechanism of H2O2 in the salttolerant response of plants.
Materials and Methods
Experimental materials
The experiment was carried out in the laboratory of Huanghuai University from August to October, 2015. Collard was selected as the research material and was provided by Nanhai Park in Zhumadian City. The H2O2 donor was 30% H2O2, the H2O2 scavenger was dimethyl thiourea, and both of them were domestic, analytically pure.
Experimental treatments
Collard seeds were sterilized and rinsed for several times with distilled water, and water on the seeds was absorbed with filter paper. The treated seeds were placed in a petri dish with filter paper, and cultured in a greenhouse［temperature: (24±2) ℃, light/darkness: 16 h/8 h, illuminance: 2 000 lx］. When the radicles of collard were 3 to 5 mm long, seedlings with uniform radicles were selected and potted. When seedlings grew to a length of about 10 cm, they were placed in a Hoagland solution and precultured in a greenhouse for 3 d. Three days later, the seedlings were divided into four treatments: control (CK): Hoagland solution, salt treatment (N): 100 mmol /L NaCl+Hoagland solution, NaCl+H2O2 treatment (N+H): 100 mmol/L NaCl+0.05 mmol/L H2O2+Hoagland solution, and NaCl+DMTU treatment (N+DMTU): 100 mmol/L NaCl+5 mmol/L DMTU+Hoagland solution. After 6 h of treatment, analysis and determination of SOD, CAT and APX activity and gene expression (SOD, GenBank: JQ321587.1; CAT, GenBank: JF720325.1; APX, GenBank: XM_013733887.1) were performed. Total RNA in leaves was extracted by guanidine thiocyanate method, and ABI7700 was used for quantitative PCR with actin (GenBank accession number: AF111812.1) as the internal reference (Table 1) according to reference［15］. Each treatment had three replicates. In order to maintain the consistency of treatment, the treatment liquid was changed every day during the treatment. After 48 h of treatment, the growth rate of collard seedlings was determined, and the dry weight, fresh weight and relative water content were determined, according to reference［16］.
Results and Analysis
Effects of applying exogenous or scavenging endogenous H2O2 on collar seedling growth under salt stress Studies on growth of collard seedlings showed that there was no significant difference between the collard seedlings treated with 50 mmol/L NaCl and seedlings in the CK, and only some old leaves withered. Under the stress of 100 mmol/L NaCl, the damage of collard seedlings increased as the upper leaves turned yellow and lower leaves wilted. When the NaCl concentration reached 150 and 200 mmol/L, leaves were seriously dehydrated, resulting in death of whole collard seedling. Therefore, in this study, 100 mmol/L NaCl was selected for the salt treatment. At this concentration, collard seedlings exhibit certain salt damage symptoms, but death of plants would not be caused. The trial test showed that the H2O2 concentration of 0.05 mmol/L had a remarkable effect on growth of collard seedlings under the stress of 100 mmol/L NaCl. Therefore, the H2O2 concentration of 0.05 mmol/L was selected in this experiment.
The growth of collard seedlings treated with 100 mmol/L NaCl was significantly inhibited, and the plant growth rate and the fresh weight, dry weight and relative water content of the aboveground part decreased significantly compared with the CK. Exogenous H2O2 significantly increased the growth rate, fresh weight, dry weight and relative water content of saltstressed collar seedlings compared with the simple salt stress treatment (Fig. 1). Under salt stress, the treatment with H2O2 scavenger significantly reduced leaf growth rate, plant fresh weight, dry weight and relative water content compared with the simple salt stress treatment, indicating that the growth of collard under salt stress was inhibited after H2O2 removal.
CK: Control, 1/2 Hoagland solution; N: 100 mmol/L NaCl; N+H: 100 mmol/L NaCl +0.05 mmol/L H2O2; N+DMTU: 100 mmol/L NaCl+5 mmol/L DMTU. Similarly hereinafter.
Fig. 1Effect of H2O2 on growth of collard seedlings under salt stress
Table 1Primer sequences
Gene name Primer sequence (3′→5′)
SOD F: CGCCATCAAGTTCAACGG
R: CAGCACCTTCAGCACTCATC
CATF: CCCACAGGACTACAGGCACA
R: AATAGCAGGGCAGAAAGCAA
APXF: TCCCACAGGACTACAGGCACA
R: ACAATAGCAGGGCAGAAAGCA
αctinF: CCCTCAGCACTTTCCAACAGATGT
R: CACACTCACCACCACGAACCAG
Effects of applying exogenous or scavenging endogenous H2O2 on activity of antioxidant enzymes in collar seedlings under salt stress
When plants are in a stressful environment, the activity of antioxidant enzymes usually increases to enhance the adaptation to adversity. Under 100 mmol/L NaCl stress, the activity of SOD in collard seedlings increased significantly, with a significant difference from the CK. The treatment with exogenous 0.05 mmol/L H2O2 could significantly increase SOD activity compared with the simple salt stress (Fig. 2). It indicates that a low concentration of exogenous H2O2 can enhance the activity of antioxidant enzymes. CAT and APX were similar to SOD.
Fig. 2Effects of H2O2 on SOD, CAT and APX activity in collard seedlings under salt stress
Effects of applying exogenous or scavenging endogenous H2O2 on gene expression of antioxidant enzymes in collar seedlings under salt stress
Compared with the CK, under the salt stress condition, the expression of SOD, CAT and APX genes increased, and showed the same trend. When exogenous H2O2 was added, the expression levels of the three genes increased, exhibiting significantly differences from the CK. When using the H2O2 scavenger, the expression of the three antioxidant protective genes in collard under salt stress were determined, and the results showed that the expression levels of the three genes were significantly lower than those under the simple salt stress (Fig. 3).
Fig. 3Quantitative analysis of SOD, CAT and AXP genes
Wei LI et al. Effect of H2O2 on Growth of Collard (Brassis oleracea) Seedlings Under Salt Stress
Discussion
When plants are subjected to salt stress, the active oxygen metabolism in plants is imbalanced, and accumulated reactive oxygen species causes salt damage［17-18］. Therefore, in this study, high concentration H2O2 treatment caused increased active oxygen in collard seedlings and decreased adaptability to salt stress, thereby resulting in increased plant damage and severely inhibited growth. Recent studies have shown that active oxygen such as H2O2 can also play a signal transduction role in plants. Trace oxygen peroxide and other reactive oxygen species play an important role in regulating certain physiological phenomena, especially in cell signal transduction. The 0.05 mmol/L H2O2 used in this study may play a certain signal role in the response to salt stress in collard, and participate in or affect the salt stress signal transduction process, thus alleviating the inhibition of salt stress on growth of collard seedlings to some extent. Salt stress can inhibit the respiratory metabolism of plants, during which intracellular ROS (such as H2O2) increases greatly, causing secondary damage to plants, such as lipid peroxidation of cell membranes. In order to eliminate ROS in plants, the activity of antioxidant enzymes in plants would increase accordingly, so as to increase salt tolerance in plants［19-20］. Under salt stress, antioxidant enzymes such as plant SOD, CAT and APX act synergistically to remove excess reactive oxygen species, which makes the active oxygen metabolism in equilibrium and protect the integrity of biofilm which thus can endure salt stress within a certain range. However, when the production of reactive oxygen species exceeds the scavenging capacity of the antioxidant system, plants are harmed［21］. SOD catalyzes the disproportionation of O-2? to avoid toxic damage of O-2? to cells, while H2O2 produced during disproportionation is scavenged by CAT, APX, etc.［22-23］. It has also been suggested that H2O2 is an important endogenous signal molecule in the active oxygen signal transduction pathway and plays an important role in plant resistance to biotic and abiotic stresses［24］. The results of this study showed that under salt stress, the activity of the three antioxidant enzymes was enhanced compared with the CK. However, under high salt stress, the appropriate concentration of H2O2 could increase the activity of SOD, CAT and APX in collard leaves, while under the action of the H2O2 scavenger, the three antioxidant enzymes decreased significantly compared with the simple salt stress treatment. It indicates that a low concentration of H2O2 plays a role of signal transduction under salt stress. H2O2 as a signaling molecule also participates in the regulation of stressrelated gene expression. Under certain conditions, H2O2 as a signaling molecule can regulate the expression of a series of related genes［25-26］. For example, when plants are infected by pathogens, H2O2 in plants induces the expression of PR1 and PAL genes［27］. Some people treated the legumes with 10 mmol/L H2O2, and found that the NOS activity in the immune response increased by nearly 8.3 times. Soybean (Glycine max L.) cells were treated with exogenous H2O2, and the cytoplasmic APX transcription level was significantly improved［28］. If cultured rice (Oryza sativa L.) cells are treated with the APX inhibitor hydroxyurea or the CAT inhibitor aminotriazole, the production of H2O2 will significantly increase, which significantly improves the transcription level of APX［29］. Other studies have shown that H2O2 activates mitogenactivated protein kinase (MAPK) to further enhance antioxidant defense enzyme activity［30］. The results of this study showed that under salt stress, the expression of the three antioxidant enzymes was positively regulated by hydrogen peroxide (Fig. 3), indicating that the improvement of plant tolerance to salt stress by the antioxidant defense system is related to the accumulation of endogenous hydrogen peroxide.
In summary, under salt stress, H2O2 is involved in the regulation of antioxidant enzyme activity in collard, and also participates in the regulation of antioxidant enzyme gene expression. It might be an important regulator of saltinduced antioxidant system in collard leaves.
References
［1］ CORREA NS, BANDEIRA JD, MARINI P, et al. Salt stress: antioxidant activity as a physiological adaptation of onion cultivars［J］. Acta Botanica Brasilica, 2013, 27(2): 394-399.
［2］ HARPREET K, SIRHINDI G, BHARDWAJ R. Alteration of antioxidant machinery by 28homobrassinolide in Brassica juncea L. under salt stress［J］. Advances in Applied Science Research, 2015, 6 (4): 166-172.
［3］ EGBICHI I, KEYSTER M, LUDIDI N. Effect of exogenous application of nitric oxide on salt stress responses of soybean［J］. South African Journal of Botany, 2014, 90(1): 131-136.
［4］ LIU YL, WANG LJ. Plant response to salt stress and salt tolerance［M］. Beijing: Science Press, 1998: 752-754.(in Chinese)
［5］ LIU AR, ZHANG YB, CHEN DK. Effects of salt stress on the growth and the antioxidant enzyme activity of Thellungiella halophila［J］. Bulletin of Botanical Research, 2006, 26(2) : 216-221.(in Chinese) ［6］ COSTA P, NETO A, BEZERRA M, et al. Antioxidantenzymatic system of two sorghum genotypes differing in salt tolerance［J］. Brazilian Journal of Plant Physiology, 2005, 17(4): 353-362.
［7］ HERNNDEZ JA, FERRER MA, JIMNEZ A, et al. Antioxidant systems and O-2?/ H2O2 production in the apoplast of pea leaves. Its relation with saltinduced necrotic lesions in minor veins［J］. Plant Physiology, 2001, 127(3): 817-831.
［8］ GAO YS, CHEN JS. Effects of La3+ on antioxidant system in wheat seedling leaves under salt stress［J］. Journal of The Chinese Rare Earth Society, 2005, 23(4): 490-495.(in Chinese)
［9］ ANDERSON BE, WARD JM, SCHROEDER JI. Evidence for an extracellular reception site for abscisic acid in commelina guard cells［J］. Plant Physiology, 1994, 104(4): 1177-1183.
［10］ MIAO YC, DONG FC, SONG CP. Hydrogen peroxide: A signal molecule in plants［J］. Journal of Biology, 2001, 18(2) : 4-6.(in Chinese)
［11］ ZHAO FY, WANG YX. Important signaling molecules in plants: H2O2［J］. Acta Botanica BorealiOccidentalia Sinica, 2006, 26(2): 427-434.(in Chinese)
［12］ LI SW, XUE LG, FENG HY, et al. H2O2 signal and its function in plants［J］. Chinese Journal of Biochemistry and Molecular Biology, 2007, 23(10): 804-810.(in Chinese)
［13］ WAHID A, PERVEEN M, GELANI S, et al. Pretreatment of seed with H2O2 improves salt tolerance of wheat seedlings by alleviation of oxidative damage and expression of stress proteins［J］. Journal of Plant Physiology, 2007, 164(3): 283-294.
［14］ CHUNG JS, ZHU JK, BRESSAN RA, et al. Reactive oxygen species mediate Na+induced SOS1 mRNA stability in Arabidopsis［J］. Plant Journal for Cell and Molecular Biology, 2008, 53 (3): 554-565.
［15］ LIU ZC, CHEN RJ, BAO DE. Effect of drought stress on growth, physiological and biochemistry indices in Jinguang plum seedlings［J］. Journal of Shenyang Aricultural University, 2008, 39(1): 100-103.(in Chinese)
［16］ LI DH, LIU H, YANG YL, et al. Downregulated expression of gene by RNA interference enhances drought tolerance in rice［J］. Rice Science, 2008, 16(1): 14-20.
［17］ ZHANG LJ, WEI Y, SONG GZ, et al. Roles of Hydrogen Peroxide in Plant Responses to Physiochemical Stresses［J］. Liaoning Agricultural Sciences, 2008(2): 33-37.(in Chinese)
［18］ GONG M, CHEN B, LI ZG, et al. Heatshockinduced cross adaptation to heat, chilling, drought and salt stress in maize seedlings and involvement of H2O2［J］. Journal of Plant Physiology, 2001, 158(9): 1125-1130.
［19］ MAO GL, XU X, MI HL, et al. Relationship between active oxygen production and plasma membrane H+——ATPase activity in calli of Lycium barbarum under salt stress［J］. Agricultural Research in the Arid Areas, 2003, 21(3): 110-113.(in Chinese)
［20］ LIU AR. Effects of salt stress on the growth and the antioxidant enzyme activity of Thellungiella halophila［J］. Bulletin of Botanical Research, 2006, 26(2): 216-221.
［21］ WANG GJ, TANG L, FAN SX, et al. Role of antioxidant machinery on crop plants in abiotic stress tolerance［J］. Journal of Shenyang Aricultural University, 2012, 43(6): 719-724.(in Chinese)
［22］ SUN WH, WANG WQ, MENG QW. Functional mechanism and enzymatic and molecular characteristic of ascorbate peroxidase in plants［J］. Plant Physiology Communications, 2005, 41 (2): 143-147.(in Chinese)
(Continued on page 184)
Key wordsBrassica oleracea L. var. acephala f. tricolor Hort.; H2O2; Salt stress; Antioxidase; Gene expression
Received: August 21, 2018Accepted: November 12, 2018
Supported by Science and Technology Development Planning Project of Henan Province (182102110305).
Wei LI (1988-), male, P. R. China, lecturer, master, devoted to research about landscape plants and landscape design.
*Corresponding author. Email: 357719846@qq.com.
Salt stress is the most common stress condition causing severe crop yield reduction. Improving plant resistance to environmental stress, especially resistance to salt stress, is the first target for stable plant growth. When plants are exposed to environmental stress, a large amount of active oxygen is produced, including hydrogen peroxide (H2O2), singlet oxygen (1O2), hydroxyl radical (?OH), superoxide anion (O-2?) and lipid peroxy radical (ROO?)［1-4］. Salt stress can rapidly induce the accumulation of reactive oxygen species in plants, causing oxidative damage to proteins and lipids［5］. There are two kinds of scavenging protection mechanisms in plants, namely enzymatic system and nonenzymatic system, of which the enzymatic system includes superoxide dismutase (SOD), catalase (CAT) and ascorbate peroxidase (APX). Studies have shown that salt stress can increase the activity of active oxygen in plants［6-8］. In recent years, many experiments have shown that H2O2 is a kind of important signaling molecule that can be produced by plant cells when responding to various stresses and further regulates a series of signal transduction of stress response［9-14］. There have been evidences showing that the accumulation of endogenous H2O2 can increase the stress resistance of plants under adverse conditions, and excessive ROS such as H2O2 can cause oxidative damage to macromolecules in cells. Wahid et al.［13］ showed that hydrogen peroxide pretreatment can keep cell membrane system intact, and in turn, improve the antioxidant capacity of wheat seeds and enhance the salt tolerance in wheat during germination. SOS1 (salt overly sensitive), which plays a key role in the salttolerant response of plants, is a Na+/H+ antiporter of Arabidopsis thaliana, and H2O2 can regulate the stability of its mRNA. However, under salt stress induction, the relation between H2O2 and the activity and expression mechanism of oxidases still remains to be fully understood. In this study, the effects of applying exogenous H2O2 or removing invivo H2O2 on growth characteristics, antioxidant enzyme activity and related gene expression of collard (Brassica oleracea L. var. acephala f. tricolor Hort.) seedlings under salt stress were investigated, so as to reveal the action mechanism of H2O2 in the salttolerant response of plants.
Materials and Methods
Experimental materials
The experiment was carried out in the laboratory of Huanghuai University from August to October, 2015. Collard was selected as the research material and was provided by Nanhai Park in Zhumadian City. The H2O2 donor was 30% H2O2, the H2O2 scavenger was dimethyl thiourea, and both of them were domestic, analytically pure.
Experimental treatments
Collard seeds were sterilized and rinsed for several times with distilled water, and water on the seeds was absorbed with filter paper. The treated seeds were placed in a petri dish with filter paper, and cultured in a greenhouse［temperature: (24±2) ℃, light/darkness: 16 h/8 h, illuminance: 2 000 lx］. When the radicles of collard were 3 to 5 mm long, seedlings with uniform radicles were selected and potted. When seedlings grew to a length of about 10 cm, they were placed in a Hoagland solution and precultured in a greenhouse for 3 d. Three days later, the seedlings were divided into four treatments: control (CK): Hoagland solution, salt treatment (N): 100 mmol /L NaCl+Hoagland solution, NaCl+H2O2 treatment (N+H): 100 mmol/L NaCl+0.05 mmol/L H2O2+Hoagland solution, and NaCl+DMTU treatment (N+DMTU): 100 mmol/L NaCl+5 mmol/L DMTU+Hoagland solution. After 6 h of treatment, analysis and determination of SOD, CAT and APX activity and gene expression (SOD, GenBank: JQ321587.1; CAT, GenBank: JF720325.1; APX, GenBank: XM_013733887.1) were performed. Total RNA in leaves was extracted by guanidine thiocyanate method, and ABI7700 was used for quantitative PCR with actin (GenBank accession number: AF111812.1) as the internal reference (Table 1) according to reference［15］. Each treatment had three replicates. In order to maintain the consistency of treatment, the treatment liquid was changed every day during the treatment. After 48 h of treatment, the growth rate of collard seedlings was determined, and the dry weight, fresh weight and relative water content were determined, according to reference［16］.
Results and Analysis
Effects of applying exogenous or scavenging endogenous H2O2 on collar seedling growth under salt stress Studies on growth of collard seedlings showed that there was no significant difference between the collard seedlings treated with 50 mmol/L NaCl and seedlings in the CK, and only some old leaves withered. Under the stress of 100 mmol/L NaCl, the damage of collard seedlings increased as the upper leaves turned yellow and lower leaves wilted. When the NaCl concentration reached 150 and 200 mmol/L, leaves were seriously dehydrated, resulting in death of whole collard seedling. Therefore, in this study, 100 mmol/L NaCl was selected for the salt treatment. At this concentration, collard seedlings exhibit certain salt damage symptoms, but death of plants would not be caused. The trial test showed that the H2O2 concentration of 0.05 mmol/L had a remarkable effect on growth of collard seedlings under the stress of 100 mmol/L NaCl. Therefore, the H2O2 concentration of 0.05 mmol/L was selected in this experiment.
The growth of collard seedlings treated with 100 mmol/L NaCl was significantly inhibited, and the plant growth rate and the fresh weight, dry weight and relative water content of the aboveground part decreased significantly compared with the CK. Exogenous H2O2 significantly increased the growth rate, fresh weight, dry weight and relative water content of saltstressed collar seedlings compared with the simple salt stress treatment (Fig. 1). Under salt stress, the treatment with H2O2 scavenger significantly reduced leaf growth rate, plant fresh weight, dry weight and relative water content compared with the simple salt stress treatment, indicating that the growth of collard under salt stress was inhibited after H2O2 removal.
CK: Control, 1/2 Hoagland solution; N: 100 mmol/L NaCl; N+H: 100 mmol/L NaCl +0.05 mmol/L H2O2; N+DMTU: 100 mmol/L NaCl+5 mmol/L DMTU. Similarly hereinafter.
Fig. 1Effect of H2O2 on growth of collard seedlings under salt stress
Table 1Primer sequences
Gene name Primer sequence (3′→5′)
SOD F: CGCCATCAAGTTCAACGG
R: CAGCACCTTCAGCACTCATC
CATF: CCCACAGGACTACAGGCACA
R: AATAGCAGGGCAGAAAGCAA
APXF: TCCCACAGGACTACAGGCACA
R: ACAATAGCAGGGCAGAAAGCA
αctinF: CCCTCAGCACTTTCCAACAGATGT
R: CACACTCACCACCACGAACCAG
Effects of applying exogenous or scavenging endogenous H2O2 on activity of antioxidant enzymes in collar seedlings under salt stress
When plants are in a stressful environment, the activity of antioxidant enzymes usually increases to enhance the adaptation to adversity. Under 100 mmol/L NaCl stress, the activity of SOD in collard seedlings increased significantly, with a significant difference from the CK. The treatment with exogenous 0.05 mmol/L H2O2 could significantly increase SOD activity compared with the simple salt stress (Fig. 2). It indicates that a low concentration of exogenous H2O2 can enhance the activity of antioxidant enzymes. CAT and APX were similar to SOD.
Fig. 2Effects of H2O2 on SOD, CAT and APX activity in collard seedlings under salt stress
Effects of applying exogenous or scavenging endogenous H2O2 on gene expression of antioxidant enzymes in collar seedlings under salt stress
Compared with the CK, under the salt stress condition, the expression of SOD, CAT and APX genes increased, and showed the same trend. When exogenous H2O2 was added, the expression levels of the three genes increased, exhibiting significantly differences from the CK. When using the H2O2 scavenger, the expression of the three antioxidant protective genes in collard under salt stress were determined, and the results showed that the expression levels of the three genes were significantly lower than those under the simple salt stress (Fig. 3).
Fig. 3Quantitative analysis of SOD, CAT and AXP genes
Wei LI et al. Effect of H2O2 on Growth of Collard (Brassis oleracea) Seedlings Under Salt Stress
Discussion
When plants are subjected to salt stress, the active oxygen metabolism in plants is imbalanced, and accumulated reactive oxygen species causes salt damage［17-18］. Therefore, in this study, high concentration H2O2 treatment caused increased active oxygen in collard seedlings and decreased adaptability to salt stress, thereby resulting in increased plant damage and severely inhibited growth. Recent studies have shown that active oxygen such as H2O2 can also play a signal transduction role in plants. Trace oxygen peroxide and other reactive oxygen species play an important role in regulating certain physiological phenomena, especially in cell signal transduction. The 0.05 mmol/L H2O2 used in this study may play a certain signal role in the response to salt stress in collard, and participate in or affect the salt stress signal transduction process, thus alleviating the inhibition of salt stress on growth of collard seedlings to some extent. Salt stress can inhibit the respiratory metabolism of plants, during which intracellular ROS (such as H2O2) increases greatly, causing secondary damage to plants, such as lipid peroxidation of cell membranes. In order to eliminate ROS in plants, the activity of antioxidant enzymes in plants would increase accordingly, so as to increase salt tolerance in plants［19-20］. Under salt stress, antioxidant enzymes such as plant SOD, CAT and APX act synergistically to remove excess reactive oxygen species, which makes the active oxygen metabolism in equilibrium and protect the integrity of biofilm which thus can endure salt stress within a certain range. However, when the production of reactive oxygen species exceeds the scavenging capacity of the antioxidant system, plants are harmed［21］. SOD catalyzes the disproportionation of O-2? to avoid toxic damage of O-2? to cells, while H2O2 produced during disproportionation is scavenged by CAT, APX, etc.［22-23］. It has also been suggested that H2O2 is an important endogenous signal molecule in the active oxygen signal transduction pathway and plays an important role in plant resistance to biotic and abiotic stresses［24］. The results of this study showed that under salt stress, the activity of the three antioxidant enzymes was enhanced compared with the CK. However, under high salt stress, the appropriate concentration of H2O2 could increase the activity of SOD, CAT and APX in collard leaves, while under the action of the H2O2 scavenger, the three antioxidant enzymes decreased significantly compared with the simple salt stress treatment. It indicates that a low concentration of H2O2 plays a role of signal transduction under salt stress. H2O2 as a signaling molecule also participates in the regulation of stressrelated gene expression. Under certain conditions, H2O2 as a signaling molecule can regulate the expression of a series of related genes［25-26］. For example, when plants are infected by pathogens, H2O2 in plants induces the expression of PR1 and PAL genes［27］. Some people treated the legumes with 10 mmol/L H2O2, and found that the NOS activity in the immune response increased by nearly 8.3 times. Soybean (Glycine max L.) cells were treated with exogenous H2O2, and the cytoplasmic APX transcription level was significantly improved［28］. If cultured rice (Oryza sativa L.) cells are treated with the APX inhibitor hydroxyurea or the CAT inhibitor aminotriazole, the production of H2O2 will significantly increase, which significantly improves the transcription level of APX［29］. Other studies have shown that H2O2 activates mitogenactivated protein kinase (MAPK) to further enhance antioxidant defense enzyme activity［30］. The results of this study showed that under salt stress, the expression of the three antioxidant enzymes was positively regulated by hydrogen peroxide (Fig. 3), indicating that the improvement of plant tolerance to salt stress by the antioxidant defense system is related to the accumulation of endogenous hydrogen peroxide.
In summary, under salt stress, H2O2 is involved in the regulation of antioxidant enzyme activity in collard, and also participates in the regulation of antioxidant enzyme gene expression. It might be an important regulator of saltinduced antioxidant system in collard leaves.
References
［1］ CORREA NS, BANDEIRA JD, MARINI P, et al. Salt stress: antioxidant activity as a physiological adaptation of onion cultivars［J］. Acta Botanica Brasilica, 2013, 27(2): 394-399.
［2］ HARPREET K, SIRHINDI G, BHARDWAJ R. Alteration of antioxidant machinery by 28homobrassinolide in Brassica juncea L. under salt stress［J］. Advances in Applied Science Research, 2015, 6 (4): 166-172.
［3］ EGBICHI I, KEYSTER M, LUDIDI N. Effect of exogenous application of nitric oxide on salt stress responses of soybean［J］. South African Journal of Botany, 2014, 90(1): 131-136.
［4］ LIU YL, WANG LJ. Plant response to salt stress and salt tolerance［M］. Beijing: Science Press, 1998: 752-754.(in Chinese)
［5］ LIU AR, ZHANG YB, CHEN DK. Effects of salt stress on the growth and the antioxidant enzyme activity of Thellungiella halophila［J］. Bulletin of Botanical Research, 2006, 26(2) : 216-221.(in Chinese) ［6］ COSTA P, NETO A, BEZERRA M, et al. Antioxidantenzymatic system of two sorghum genotypes differing in salt tolerance［J］. Brazilian Journal of Plant Physiology, 2005, 17(4): 353-362.
［7］ HERNNDEZ JA, FERRER MA, JIMNEZ A, et al. Antioxidant systems and O-2?/ H2O2 production in the apoplast of pea leaves. Its relation with saltinduced necrotic lesions in minor veins［J］. Plant Physiology, 2001, 127(3): 817-831.
［8］ GAO YS, CHEN JS. Effects of La3+ on antioxidant system in wheat seedling leaves under salt stress［J］. Journal of The Chinese Rare Earth Society, 2005, 23(4): 490-495.(in Chinese)
［9］ ANDERSON BE, WARD JM, SCHROEDER JI. Evidence for an extracellular reception site for abscisic acid in commelina guard cells［J］. Plant Physiology, 1994, 104(4): 1177-1183.
［10］ MIAO YC, DONG FC, SONG CP. Hydrogen peroxide: A signal molecule in plants［J］. Journal of Biology, 2001, 18(2) : 4-6.(in Chinese)
［11］ ZHAO FY, WANG YX. Important signaling molecules in plants: H2O2［J］. Acta Botanica BorealiOccidentalia Sinica, 2006, 26(2): 427-434.(in Chinese)
［12］ LI SW, XUE LG, FENG HY, et al. H2O2 signal and its function in plants［J］. Chinese Journal of Biochemistry and Molecular Biology, 2007, 23(10): 804-810.(in Chinese)
［13］ WAHID A, PERVEEN M, GELANI S, et al. Pretreatment of seed with H2O2 improves salt tolerance of wheat seedlings by alleviation of oxidative damage and expression of stress proteins［J］. Journal of Plant Physiology, 2007, 164(3): 283-294.
［14］ CHUNG JS, ZHU JK, BRESSAN RA, et al. Reactive oxygen species mediate Na+induced SOS1 mRNA stability in Arabidopsis［J］. Plant Journal for Cell and Molecular Biology, 2008, 53 (3): 554-565.
［15］ LIU ZC, CHEN RJ, BAO DE. Effect of drought stress on growth, physiological and biochemistry indices in Jinguang plum seedlings［J］. Journal of Shenyang Aricultural University, 2008, 39(1): 100-103.(in Chinese)
［16］ LI DH, LIU H, YANG YL, et al. Downregulated expression of gene by RNA interference enhances drought tolerance in rice［J］. Rice Science, 2008, 16(1): 14-20.
［17］ ZHANG LJ, WEI Y, SONG GZ, et al. Roles of Hydrogen Peroxide in Plant Responses to Physiochemical Stresses［J］. Liaoning Agricultural Sciences, 2008(2): 33-37.(in Chinese)
［18］ GONG M, CHEN B, LI ZG, et al. Heatshockinduced cross adaptation to heat, chilling, drought and salt stress in maize seedlings and involvement of H2O2［J］. Journal of Plant Physiology, 2001, 158(9): 1125-1130.
［19］ MAO GL, XU X, MI HL, et al. Relationship between active oxygen production and plasma membrane H+——ATPase activity in calli of Lycium barbarum under salt stress［J］. Agricultural Research in the Arid Areas, 2003, 21(3): 110-113.(in Chinese)
［20］ LIU AR. Effects of salt stress on the growth and the antioxidant enzyme activity of Thellungiella halophila［J］. Bulletin of Botanical Research, 2006, 26(2): 216-221.
［21］ WANG GJ, TANG L, FAN SX, et al. Role of antioxidant machinery on crop plants in abiotic stress tolerance［J］. Journal of Shenyang Aricultural University, 2012, 43(6): 719-724.(in Chinese)
［22］ SUN WH, WANG WQ, MENG QW. Functional mechanism and enzymatic and molecular characteristic of ascorbate peroxidase in plants［J］. Plant Physiology Communications, 2005, 41 (2): 143-147.(in Chinese)
(Continued on page 184)