论文部分内容阅读
Abstract A gramnegative， motile， and rodshaped bacterium， strain JF02， was isolated from the liver of diseased GIFT （genetically improved farmed tilapia） in Hainan， China. The strain JF02 was lethal to GIFT， and most GIFT infected with JF02 exhibited the same clinical signs， such as black body， pale or focally necrosis of the gills， scale shedding， fin rot， liver hyperemia， and hydroabdomen. The 16S rRNA gene sequences of strain JF02 showed 99.7% similarity with that of Shewanella xiamenensis strain S4T. In addition， the gyrB gene sequences of strain JF02 showed 99.0% similarity with that of S. xiamenensis strain S4T. Combining the results of morphological， physiological and biochemical characteristics， the isolated strain JF02 was confirmed to be S. xiamenensis. The chemotherapeutic antibiotics tests showed that the strain JF02 was sensitive to most antibiotics except for several common antibiotics that were frequently used in human medicines and treatment of bacterial diseases of fish， indicating that the strain JF02 has obtained many antibiotic resistance genes due to the longterm abuse of antibiotics in aquaculture. In this paper， it was the first time to report that the S. xiamenensis may be a potential pathogen for GIFT. It is time to promote awareness of the potential harm of this strain to the health of human and aquatic animals.
Key words GIFT； Shewanella xiamenensis； Isolation； Identification
Received： December 1， 2017 Accepted： January 5， 2018
Supported by Major Scientific and Technological Projects of Hainan Province （ZDKJ2016009）； grant from the Doctoral Research Project of Hainan Tropical Ocean University.
Jun MA （1982-）， male， P. R. China， PhD， associate professor， devoted to the research about marine biology， Email：231799220@qq.com； Ning YANG （1980-）， male， P. R. China， master， senior engineer， devoted to the research about aquaculture， Email： dayangning@163.com.
*These authors contributed equally to this work.
** Corresponding author. Email： huanghai74@126.com.
The genetically improved farmed tilapia （GIFT）， which was selected and bred by genetic improvement technology in 1989， is an important economic fish[1]. Compared with wild tilapia， GIFT has a high commercial value， and has been widely farmed for 20 years in Hainan Province and other regions in South China. However， as fish culture industry develops， more and more diseases appear and seriously hamper GIFT culture. Recently， a very serious disease broke out in a tilapia farm of Hainan Province. Its clinical signs are black body， scale shedding， fin rot， liver hyperemia， and hydroabdomen. It spreads very quickly and most diseased fishes die in a few days. The strains of genus Shewanella were frequently isolated from these diseased fishes in the study. The members of genus Shewanella are facultatively anaerobic， gramnegative， and motile bacilli. Originally， the genus was established for Alteromonas putrefaciens rarely isolated from butter and clinical samples in 1985[2]. Based on phylogenetic and physiological characteristics， the genus Shewanella is divided roughly into two groups. Members of one group， represented by Shewanella putrefaciens， are nonhalophilic， mesophilic， and lack the ability to produce eicosapentaenoic acid （EPA）. The other group is represented by Shewanella benthica， which was isolated from the deep sea and is psychrophilic and halophilic and can produce large amounts of EPA[3]. However， advanced taxonomic techniques have contributed to more than 60 accepted or proposed Shewanella species[4].
Members of the genus Shewanella are widely distributed in nature， especially in aquatic environments such as fresh water and the ocean[5-6]. Growing research suggests that more species of genus Shewanella as an important and developing cause of maritimeassociated diseases can lead to human diseases[7-11]. However， their role in the pathogenesis of the diseases of aquatic animals is not clearly understood. Some studies have shown that the major pathogenic species in the genus may not be S. putrefaciens and that other Shewanella species （such as Shewanella alga and Shewanella haliotis） have the capability to cause disease[7-8， 11]. In 2011， S. xiamenensis， which was described as the Shewanella sp. nov. from coastal sea sediments[12]， was implicated in a health careassociated peripancreatic infection， where Shewanellae were recovered in conjunction with Staphylococcus epidermidis from drainage and surgical samples[10]. Unfortunately， no information is available regarding these isolates， so both the source and possible clinical significance of the species remain unknown.
In China， the pathogenicity of Shewanella on aquatic animals has gradually aroused peoples concern[13]. In this paper， we isolated the S. xiamenensis from diseased GIFT， to confirm the identification of bacterial strains and demonstrate the pathogenic potential of S. xiamenensis strains by using the infection experiment. Our studies indicate that S. xiamenensis may be a potential pathogen for tilapia aquaculture.
Materials and Methods
Bacterial isolation
An incidence of disease was observed in a GIFT individual weighin （19.60±0.93）g， collected from a tilapia farm of Hainan Province， China. Nearly 100% of the fish in the sampled farms displayed signs of black body， and 20%-40% of the diseased fishes displayed signs of scale shedding， liver hyperaemia， and hydroabdomen. The fish were first sanitized with 70% alcohol and dissected in the laboratory. The different tissues （including the liver， spleen， kidney， and intestine） isolated from the diseased fish were grinded with the sterile homogenate at 4 ℃， the tissue homogenates were filtered with sterile gauze. All filtrates were inoculated onto nutrition agar and cultured at 30 ℃ for 24 h. The dominant isolates were purified by streaking and restreaking on the same agar plates. Pure stock isolates were stored at -80 ℃ with 15% glycerol.
Virulence tests of strain to GIFT
Healthy fish （GIFT） weighing （15.28±0.89）g each were held in 100 liter tanks at 25-28 ℃. The virulence tests with batches of 10 fish were conducted by intraperitoneal （I.P.） injection of bacterial suspensions （1 × 107 CFU per fish after a 24 h culture） into the abdominal cavity. Sterile saline was injected into another group of animals as parallel controls. Each group was duplicated， and mortalities were recorded daily for 10 d after injection. Reisolation on TSA plates and identification of the bacteria from the liver of diseased fish were performed after bacterial challenge. All animal challenges were carried out following IACUCapproved protocols of Hainan Tropical Ocean University.
Related to LC50 determination method of experimental animals， the intraperitoneal injection method was used to infect tilapia and determine the half lethal concentration （LC50） of pathogenic bacteria. The experimental fish were divided into six groups， five groups were separately injected with bacterial solution of 1 × 107， 1 × 106， 1 ×105， 1 × 104 or 1 × 103 CFU/ml， and the control group was injected with sterile saline. The death data were recorded within 10 d after infection， and the median lethal concentrations （LC50） of strain JF02 was determined by probit analysis with SPSS 19.0 software.
Bacterial identification
Gram staining and cell morphology were examined by light microscopy using exponentially growing cells. The temperature ranges for growth were examined in nutrition agar. Tests for salt tolerance were carried out in LB broth with different NaCl concentrations. All classical phenotypic tests were performed using standard methods according to Bergeys manual of determinative bacteriology[14].
Strains were cultured at 30 ℃ for 24 h in nutrient broth （HKM， China）， and genomic DNA was extracted using the bacterial DNA kit （Axygen AxyPrepTM） following the manufacturers instructions for 16S rRNA and gyrB gene amplification. The nearly complete 16S rRNA gene was amplified with primers 27F （5AGAGTTTGATCMTGGCTCAG3） and 1492R （5TACGGCTACCTTGTTACGACTT3）， as described previously[15]. The gyrB gene was amplified and sequenced using primers UP1S （5GAAGTCATCATGACCGTTCTGCA3） and UP2Sr （5AGCAGGGTACGGATGTGCGAGC3）[16]. The amplified products were sequenced by gene sequencing company （BGI， China）. These gene sequences were aligned and compared to the GenBank nucleotide database using an online BLAST search. Phylogenetic trees were constructed with the neighbourjoining method using the MEGA software[17]. Sensitivity of strain JF02 to various chemotherapeutic agents
Strain JF02 was tested for sensitivity to 20 chemotherapeutic agents by the disc diffusion method as recommended by the Clinical and Laboratory Standards Institute[18]. Briefly， 5 ml of trypticase soy broth （TSB， HKM， China） was inoculated with the identified strain. The suspension obtained was uniformly spread onto the surface of dry MuellerHinton agar （MH， HKM， China） plates using brothimpregnated swabs. The inoculum concentration was approximately 1 × 108 CFU/ml. The following discs were used： azithromycin （15 μg）， amoxicillin （10 μg）， ampicillin （10 μg）， ofloxacin （5 μg）， ciprofloxacin （10 μg）， amikacin （30 μg）， bacillosporin （300 μg）， enrofloxacin （10 μg）， orfloxacin （10 μg）， cotrimoxazole （3.75 μg）， nitrofurantion （300 μg）， rifampicin （5 μg）， lincomycin （2 μg）， ceftriaxone （30 μg）， kanamycin （30 μg）， trimethoprim （5 μg）， chlorodeoxy lincomycin （2 μg）， cefoperazone （75 μg）， netilmicin （30 μg）， streptomycin （10 μg）， minocycline （30 μg）， penicillin （10 μg）， doxycycline （30 μg）， gentamicin （10 μg）， tetracycline （30 μg）， tobramycin （10 μg）， cefalotin （30 μg）， vancocin （30 μg）， neomycin （30 μg）， cephalosporinum （30 μg）， and cephazolin （30 μg）. The plates were incubated at 30 ℃ for 18 h and the inhibition of the bacteria by the chemotherapeutic agents was scored.
Results and Analysis
Bacterial isolation
The sick fish had obviously clinical symptoms， such as black body， scale shedding， fin rot， liver hyperemia， and hydroabdomen. The bacteria were not isolated from the kidney and spleen， and a small number of bacteria were isolated from the intestinal tract. A number of single colonies of bacteria were separated from the pathologically changed part of the liver in sick fish. Then two dominant colonies （were numbered JF01 and JF02， respectively） were randomly selected and inoculated into TSB for stock culture.
Virulence of strain JF02 to GIFT
Bacterial cells （1.0×107 CFU/ml） of isolated strains （including the strain JF01 and JF02） were injected separately into GIFT individuals for virulence test， and the results showed that only JF02 was lethal to GIFT. Three days after injection with strain JF02， most GIFT exhibited the same clinical signs （black body， pale or focally necrosis of the gills， scale shedding， fin rot， liver hyperemia， and hydroabdomen） as those observed in naturally infected GIFT. Strain JF02 could be reisolated as pure colonies from the lives of all injected fishes and the reisolated strain was also strongly virulent to healthy GIFT. When the concentration of bacteria was 1 ×107 CFU/ml， the mortality rate of the infected GIFT was 100%. When the concentration of bacteria was 1 ×103 CFU/ml， the mortality rate was 0% （Table.1）. The median lethal concentration （LC50） of the pathogenic strain JF02 was 1.41 × 105 CFU/ml. The isolated strain JF02 was selected to investigate the biochemical reactions （as shown in Table 2）. Briefly， strain JF02 was motile gramnegative rods. Colonies on nutrition agar are smooth， circular， slightly yellow in color and convex with clear edges. Growth of strain JF02 occurs at 37 ℃， but not above 37 ℃.
Table 2 Main phenotypic traits of strains JF02 and S. xiamenensis sp. nov. S4T
Test methodsCharacteristicsJF02S. xiamenensis sp.nov. S4T
MicroscopeGram stain--
Colony morphologyShort rodRod
Growth at/in4 ℃ culture-+
37 ℃ culture++
40 ℃ culture--
0% NaCl++
6% NaCl-+
Utilization ofCellobiose--
Sucrose++
Glucose++
Glycogen++
Maltose-+
Arabia sugar-+
Galactose--
αCyclodextrin++
Urea--
Lactate++
Citricum--
Dextrin++
Malate++
Caprate++
Glutamate--
Production ofArginine dihydrolase+-
Oxidase++
Catalase++
Reduction ofNitrate-+
'+' represents the positive more than 90%； '-' represents the negative more than 90%.
Sodium ions are not required for growth （growth occurs in the presence of 0-4% NaCl and optimal growth occurs in 1%-2% NaCl）. The strain was positive for oxidase， catalase and arginine dihydrolase. Nitrate was not reduced as electron acceptors and a limited range of carbon sources was utilized， such as glucose， sucrose， glycogen， αcyclodextrin， lactate， etc. All biochemical characteristics tested on strain JF02 were approximately consistent with the S. xiamenensis sp. nov. S4T[12] except that acid was not produced from arabinose and maltose.
The nearly complete 16S rRNA gene sequences of strains JF02 （KC916743） was amplified and sequenced in this study. This sequence was compared with those of the strains of recognized Shewanella species. The results showed that strain JF02 exhibited 16S rRNA gene sequence similarity of 94.7%-99.7% to the strains of the other 17 Shewanella species. Among these， strain JF02 showed 99.7% similarity with the S. xiamenensism strain S4T （FJ589031） （Fig.1）.
Though the 16S rRNA gene sequence is accepted as defining phylogenetic relationships between bacterial species， it sometimes lacks sufficient specificity for the differentiation of close relatives[9， 18]. Therefore， the more rapidly evolving gyrB gene was employed to distinguish closely related strains. The gyrB gene sequence of strain JF02 （KX185932） exhibited 78.1%-99.0% similarity to those of the type strains of nine closely related Shewanella species， and the strain JF02 showed 99.0% similarity with the S. xiamenensism strain S4T （FJ589031） （Fig. 2）. Sensitivity of strain JF02 to various chemotherapeutic agents
The results of the sensitivity tests indicated that strain JF02 was susceptible to most different chemotherapeutic antibiotics as shown in Table 3. It was moderately susceptible to bacillosporin， cotrimoxazole， and cephazolin. It should be noted that the strain JF02 has produced resistance to these commonly used antibiotics， such as amoxicillin， penicillin， tetracycline， enrofloxacin， lincomycin and clindamycin. It should be recognized that the strain JF02 has the resistance to vancomycin， which has been used to challenge the methicillin resistant Staphylococcus aureus.
The tree was constructed using the neighbourjoining method， and genetic distances were computed from Kimuras twoparameter model. Bootstrap values， expressed as percentages of 1 000 replications， are given at branching points. Bar， 0.01 substitutions per nucleotide position.
Fig. 1 Phylogenetic placement of strain JF02 according to 16S rRNA gene sequence analysis
The tree was constructed using the neighborjoining method， and genetic distances were computed from Kimuras twoparameter model. Bootstrap values， expressed as percentages of 1 000 replications， are given at branching points. Bar， 0.01 substitutions per nucleotide position.
Fig. 2 Phylogenetic placement of strain JF02 according to gyrB gene sequence analysis
Table 3 Sensitivity of strain JF02 to various chemotherapeutic agents.
Chemotherapeutic agentsDisc concentration∥μgSensitivitya
PenicillinsAmoxicillin10R
Penicillin10R
Ampicillin10S
CephalosporinsCeftriaxone30S
Cefoperazone75S
Cephalothin30S
Cephalosporin30S
Cephazolin 30MS
TetracyclineTetracycline30R
Minocycline30S
Doxycycline30S
MacrolidesAzithromycin15S
SulphonamidesCotrimoxazole3.75MS
Trimethoprim5S
Quinolones andEnrofloxacin10R
FluoroquinolonesOfloxacin5S
Ciprofloxacin10S
Orfloxacin10S
LincosamidesLincomycin2R
Clindamycin2R
AminoglycosideAmikacin30S
Kanamycin30S
Netilmicin30S
Streptomycin10S
Gentamicin10S
Tobramycin10S
GlycopeptideVancomycin30R
Neomycin30S
OthersBacillosporin300MS
Nitrofurantion300S
Rifampicin5S
R， resistant； S， sensitive； MS， moderately sensitive.
Discussion
A strain JF02 was obtained from GIFT with common clinical signs of disease （such as black body， pale or focally necrosis of the gills， scale shedding， fin rot， liver hyperemia， and hydroabdomen） that have been reported in carp and rainbow trout infected by S. putrefaciens[19]. The virulence test showed that JF02 was strongly virulent to GIFT， and the LC50 was 1.41×105 CFU/ml. Besides， the strain JF02 was also detected to have the similar phenotypic characteristics to S. xiamenensis sp. nov. S4T strain[12]. Meanwhile， the 16S rRNA gene sequence of strain JF02 showed the highest similarity with that of S. xiamenensis strain S4. However， since it was found that the 16S rRNA gene can not distinguish between some closely related species， the gyrB gene， which encodes the Bsubunit of DNA gyrase， has been shown to be a suitable molecular marker for the higher nucleic base substitutions[20-21]. Moreover， the gyrB genes are essential and ubiquitous throughout microorganisms and are sufficiently large in size for use in analysis of microbial communities[22]. So， the gyrB gene is used to as the exceptionally molecular marker to evaluate the species. In this study， the 16S rRNA and gyrB of strain JF02 were both similar to those of S. xiamenensis strain S4 （refer to FJ589031 and FJ589040）. Combining with results of biochemical， it can be presumed that the isolated strain JF02 was S. xiamenensis， which was for the first time reported as a pathogen for GIFT. The chemotherapeutic antibiotics tests showed that the strain JF02 was sensitive to most antibiotics as shown in Table.3. Several commonly used antibiotics （such as amoxicillin， penicillin， tetracyclin， lincomycin and clindamycin）， which were used frequently in human medicines[23] and the treatment of bacterial diseases of fish[24]， had not controlled the strain JF02. It means that the strain JF02 has obtained the resistance to many antibiotics due to the longterm abuse of antibiotics in aquaculture. The genus Shewanella may be identified by antibiotic resistance determinants， such as βlactamases and quinolone[25-27]. In this study， the enrofloxacin of quinolones commonly used in aquaculture also failed to challenge this strain. The results showed that the strain JF02 has obtained quinolone resistance， and belongs to the genus Shewanella. These results of antibiotic tests explained why this epidemic disease of GIFT was a common phenomenon in Hainan Province. Remarkably， the strain JF02 has obtained the resistance to vancomycin， which has been used to challenge the methicillin resistant Staphylococcus aureus.
Some studies suggested that several species of genus Shewanella can cause the diseases to human[28-29]. Since we have isolated S. xiamenensis from GIFT in different farms in Hainan Province， it seems that appropriate aquaculture management is essential to avoid the pathogen threat to GIFT and/or the staff of fish farms. Until now， S. xiamenensis has caused increasingly serious threat on human health and aquatic production. It is time to promote awareness of focusing on the research of S. xiamenensis， such as species identification， phylogenetic relationship， epidemiology， pathogenesis and pathology， to prevent the bacteria from damaging human and aquatic production in the future.
References
[1] PULLIN RSV， EKNATH AE， GJEDREM T， et al. The Genetic Improvement of Farmed Tilapias （GIFT） project： the story so far[J]. Naga， 1991， 14： 3-6.
[2] HUANG WM. Bacterial diversity based on type II DNA topoisomerase genes[J]. Annu Rev Genet 1996， 30： 79-107.
[3] Macdonell MT， Colwell RR （1985） Phylogeny of the Vibrionaceae， and Recommendation for Two New Genera， Listonella and Shewanella. Systematic & Applied Microbiology 6：171-182.
[4] RUSSELL NJ， NICHOLS DS. Polyunsaturated fatty acids in marine bacteria——a dogma rewritten[J]. Microbiology， 1999， 145 （ Pt 4）：767-779.
[5] JANDA JM， ABBOTT SL. The genus Shewanella： from the briny depths below to human pathogen[J]. Crit Rev Microbiol， 2014， 40： 293-312.
[6] HOLT HM， GAHRNHANSEN B， BRUUN B. Shewanella algae and Shewanella putrefaciens： clinical and microbiological characteristics[J]. Clin Microbiol Infect， 2005， 11： 347-352.
[7] HAU HH， GRALNICK JA. Ecology and biotechnology of the genus Shewanella[J]. Annu Rev Microbiol， 2007， 61： 237-258.
[8] NOZUE H， HAYASHI T， HASHIMOTO Y， et al. Isolation and characterization of Shewanella alga from human clinical specimens and emendation of the description of S. alga Simidu et al.， 1990， 335[J]. Int J Syst Bacteriol， 1992， 42： 628-634.
Key words GIFT； Shewanella xiamenensis； Isolation； Identification
Received： December 1， 2017 Accepted： January 5， 2018
Supported by Major Scientific and Technological Projects of Hainan Province （ZDKJ2016009）； grant from the Doctoral Research Project of Hainan Tropical Ocean University.
Jun MA （1982-）， male， P. R. China， PhD， associate professor， devoted to the research about marine biology， Email：231799220@qq.com； Ning YANG （1980-）， male， P. R. China， master， senior engineer， devoted to the research about aquaculture， Email： dayangning@163.com.
*These authors contributed equally to this work.
** Corresponding author. Email： huanghai74@126.com.
The genetically improved farmed tilapia （GIFT）， which was selected and bred by genetic improvement technology in 1989， is an important economic fish[1]. Compared with wild tilapia， GIFT has a high commercial value， and has been widely farmed for 20 years in Hainan Province and other regions in South China. However， as fish culture industry develops， more and more diseases appear and seriously hamper GIFT culture. Recently， a very serious disease broke out in a tilapia farm of Hainan Province. Its clinical signs are black body， scale shedding， fin rot， liver hyperemia， and hydroabdomen. It spreads very quickly and most diseased fishes die in a few days. The strains of genus Shewanella were frequently isolated from these diseased fishes in the study. The members of genus Shewanella are facultatively anaerobic， gramnegative， and motile bacilli. Originally， the genus was established for Alteromonas putrefaciens rarely isolated from butter and clinical samples in 1985[2]. Based on phylogenetic and physiological characteristics， the genus Shewanella is divided roughly into two groups. Members of one group， represented by Shewanella putrefaciens， are nonhalophilic， mesophilic， and lack the ability to produce eicosapentaenoic acid （EPA）. The other group is represented by Shewanella benthica， which was isolated from the deep sea and is psychrophilic and halophilic and can produce large amounts of EPA[3]. However， advanced taxonomic techniques have contributed to more than 60 accepted or proposed Shewanella species[4].
Members of the genus Shewanella are widely distributed in nature， especially in aquatic environments such as fresh water and the ocean[5-6]. Growing research suggests that more species of genus Shewanella as an important and developing cause of maritimeassociated diseases can lead to human diseases[7-11]. However， their role in the pathogenesis of the diseases of aquatic animals is not clearly understood. Some studies have shown that the major pathogenic species in the genus may not be S. putrefaciens and that other Shewanella species （such as Shewanella alga and Shewanella haliotis） have the capability to cause disease[7-8， 11]. In 2011， S. xiamenensis， which was described as the Shewanella sp. nov. from coastal sea sediments[12]， was implicated in a health careassociated peripancreatic infection， where Shewanellae were recovered in conjunction with Staphylococcus epidermidis from drainage and surgical samples[10]. Unfortunately， no information is available regarding these isolates， so both the source and possible clinical significance of the species remain unknown.
In China， the pathogenicity of Shewanella on aquatic animals has gradually aroused peoples concern[13]. In this paper， we isolated the S. xiamenensis from diseased GIFT， to confirm the identification of bacterial strains and demonstrate the pathogenic potential of S. xiamenensis strains by using the infection experiment. Our studies indicate that S. xiamenensis may be a potential pathogen for tilapia aquaculture.
Materials and Methods
Bacterial isolation
An incidence of disease was observed in a GIFT individual weighin （19.60±0.93）g， collected from a tilapia farm of Hainan Province， China. Nearly 100% of the fish in the sampled farms displayed signs of black body， and 20%-40% of the diseased fishes displayed signs of scale shedding， liver hyperaemia， and hydroabdomen. The fish were first sanitized with 70% alcohol and dissected in the laboratory. The different tissues （including the liver， spleen， kidney， and intestine） isolated from the diseased fish were grinded with the sterile homogenate at 4 ℃， the tissue homogenates were filtered with sterile gauze. All filtrates were inoculated onto nutrition agar and cultured at 30 ℃ for 24 h. The dominant isolates were purified by streaking and restreaking on the same agar plates. Pure stock isolates were stored at -80 ℃ with 15% glycerol.
Virulence tests of strain to GIFT
Healthy fish （GIFT） weighing （15.28±0.89）g each were held in 100 liter tanks at 25-28 ℃. The virulence tests with batches of 10 fish were conducted by intraperitoneal （I.P.） injection of bacterial suspensions （1 × 107 CFU per fish after a 24 h culture） into the abdominal cavity. Sterile saline was injected into another group of animals as parallel controls. Each group was duplicated， and mortalities were recorded daily for 10 d after injection. Reisolation on TSA plates and identification of the bacteria from the liver of diseased fish were performed after bacterial challenge. All animal challenges were carried out following IACUCapproved protocols of Hainan Tropical Ocean University.
Related to LC50 determination method of experimental animals， the intraperitoneal injection method was used to infect tilapia and determine the half lethal concentration （LC50） of pathogenic bacteria. The experimental fish were divided into six groups， five groups were separately injected with bacterial solution of 1 × 107， 1 × 106， 1 ×105， 1 × 104 or 1 × 103 CFU/ml， and the control group was injected with sterile saline. The death data were recorded within 10 d after infection， and the median lethal concentrations （LC50） of strain JF02 was determined by probit analysis with SPSS 19.0 software.
Bacterial identification
Gram staining and cell morphology were examined by light microscopy using exponentially growing cells. The temperature ranges for growth were examined in nutrition agar. Tests for salt tolerance were carried out in LB broth with different NaCl concentrations. All classical phenotypic tests were performed using standard methods according to Bergeys manual of determinative bacteriology[14].
Strains were cultured at 30 ℃ for 24 h in nutrient broth （HKM， China）， and genomic DNA was extracted using the bacterial DNA kit （Axygen AxyPrepTM） following the manufacturers instructions for 16S rRNA and gyrB gene amplification. The nearly complete 16S rRNA gene was amplified with primers 27F （5AGAGTTTGATCMTGGCTCAG3） and 1492R （5TACGGCTACCTTGTTACGACTT3）， as described previously[15]. The gyrB gene was amplified and sequenced using primers UP1S （5GAAGTCATCATGACCGTTCTGCA3） and UP2Sr （5AGCAGGGTACGGATGTGCGAGC3）[16]. The amplified products were sequenced by gene sequencing company （BGI， China）. These gene sequences were aligned and compared to the GenBank nucleotide database using an online BLAST search. Phylogenetic trees were constructed with the neighbourjoining method using the MEGA software[17]. Sensitivity of strain JF02 to various chemotherapeutic agents
Strain JF02 was tested for sensitivity to 20 chemotherapeutic agents by the disc diffusion method as recommended by the Clinical and Laboratory Standards Institute[18]. Briefly， 5 ml of trypticase soy broth （TSB， HKM， China） was inoculated with the identified strain. The suspension obtained was uniformly spread onto the surface of dry MuellerHinton agar （MH， HKM， China） plates using brothimpregnated swabs. The inoculum concentration was approximately 1 × 108 CFU/ml. The following discs were used： azithromycin （15 μg）， amoxicillin （10 μg）， ampicillin （10 μg）， ofloxacin （5 μg）， ciprofloxacin （10 μg）， amikacin （30 μg）， bacillosporin （300 μg）， enrofloxacin （10 μg）， orfloxacin （10 μg）， cotrimoxazole （3.75 μg）， nitrofurantion （300 μg）， rifampicin （5 μg）， lincomycin （2 μg）， ceftriaxone （30 μg）， kanamycin （30 μg）， trimethoprim （5 μg）， chlorodeoxy lincomycin （2 μg）， cefoperazone （75 μg）， netilmicin （30 μg）， streptomycin （10 μg）， minocycline （30 μg）， penicillin （10 μg）， doxycycline （30 μg）， gentamicin （10 μg）， tetracycline （30 μg）， tobramycin （10 μg）， cefalotin （30 μg）， vancocin （30 μg）， neomycin （30 μg）， cephalosporinum （30 μg）， and cephazolin （30 μg）. The plates were incubated at 30 ℃ for 18 h and the inhibition of the bacteria by the chemotherapeutic agents was scored.
Results and Analysis
Bacterial isolation
The sick fish had obviously clinical symptoms， such as black body， scale shedding， fin rot， liver hyperemia， and hydroabdomen. The bacteria were not isolated from the kidney and spleen， and a small number of bacteria were isolated from the intestinal tract. A number of single colonies of bacteria were separated from the pathologically changed part of the liver in sick fish. Then two dominant colonies （were numbered JF01 and JF02， respectively） were randomly selected and inoculated into TSB for stock culture.
Virulence of strain JF02 to GIFT
Bacterial cells （1.0×107 CFU/ml） of isolated strains （including the strain JF01 and JF02） were injected separately into GIFT individuals for virulence test， and the results showed that only JF02 was lethal to GIFT. Three days after injection with strain JF02， most GIFT exhibited the same clinical signs （black body， pale or focally necrosis of the gills， scale shedding， fin rot， liver hyperemia， and hydroabdomen） as those observed in naturally infected GIFT. Strain JF02 could be reisolated as pure colonies from the lives of all injected fishes and the reisolated strain was also strongly virulent to healthy GIFT. When the concentration of bacteria was 1 ×107 CFU/ml， the mortality rate of the infected GIFT was 100%. When the concentration of bacteria was 1 ×103 CFU/ml， the mortality rate was 0% （Table.1）. The median lethal concentration （LC50） of the pathogenic strain JF02 was 1.41 × 105 CFU/ml. The isolated strain JF02 was selected to investigate the biochemical reactions （as shown in Table 2）. Briefly， strain JF02 was motile gramnegative rods. Colonies on nutrition agar are smooth， circular， slightly yellow in color and convex with clear edges. Growth of strain JF02 occurs at 37 ℃， but not above 37 ℃.
Table 2 Main phenotypic traits of strains JF02 and S. xiamenensis sp. nov. S4T
Test methodsCharacteristicsJF02S. xiamenensis sp.nov. S4T
MicroscopeGram stain--
Colony morphologyShort rodRod
Growth at/in4 ℃ culture-+
37 ℃ culture++
40 ℃ culture--
0% NaCl++
6% NaCl-+
Utilization ofCellobiose--
Sucrose++
Glucose++
Glycogen++
Maltose-+
Arabia sugar-+
Galactose--
αCyclodextrin++
Urea--
Lactate++
Citricum--
Dextrin++
Malate++
Caprate++
Glutamate--
Production ofArginine dihydrolase+-
Oxidase++
Catalase++
Reduction ofNitrate-+
'+' represents the positive more than 90%； '-' represents the negative more than 90%.
Sodium ions are not required for growth （growth occurs in the presence of 0-4% NaCl and optimal growth occurs in 1%-2% NaCl）. The strain was positive for oxidase， catalase and arginine dihydrolase. Nitrate was not reduced as electron acceptors and a limited range of carbon sources was utilized， such as glucose， sucrose， glycogen， αcyclodextrin， lactate， etc. All biochemical characteristics tested on strain JF02 were approximately consistent with the S. xiamenensis sp. nov. S4T[12] except that acid was not produced from arabinose and maltose.
The nearly complete 16S rRNA gene sequences of strains JF02 （KC916743） was amplified and sequenced in this study. This sequence was compared with those of the strains of recognized Shewanella species. The results showed that strain JF02 exhibited 16S rRNA gene sequence similarity of 94.7%-99.7% to the strains of the other 17 Shewanella species. Among these， strain JF02 showed 99.7% similarity with the S. xiamenensism strain S4T （FJ589031） （Fig.1）.
Though the 16S rRNA gene sequence is accepted as defining phylogenetic relationships between bacterial species， it sometimes lacks sufficient specificity for the differentiation of close relatives[9， 18]. Therefore， the more rapidly evolving gyrB gene was employed to distinguish closely related strains. The gyrB gene sequence of strain JF02 （KX185932） exhibited 78.1%-99.0% similarity to those of the type strains of nine closely related Shewanella species， and the strain JF02 showed 99.0% similarity with the S. xiamenensism strain S4T （FJ589031） （Fig. 2）. Sensitivity of strain JF02 to various chemotherapeutic agents
The results of the sensitivity tests indicated that strain JF02 was susceptible to most different chemotherapeutic antibiotics as shown in Table 3. It was moderately susceptible to bacillosporin， cotrimoxazole， and cephazolin. It should be noted that the strain JF02 has produced resistance to these commonly used antibiotics， such as amoxicillin， penicillin， tetracycline， enrofloxacin， lincomycin and clindamycin. It should be recognized that the strain JF02 has the resistance to vancomycin， which has been used to challenge the methicillin resistant Staphylococcus aureus.
The tree was constructed using the neighbourjoining method， and genetic distances were computed from Kimuras twoparameter model. Bootstrap values， expressed as percentages of 1 000 replications， are given at branching points. Bar， 0.01 substitutions per nucleotide position.
Fig. 1 Phylogenetic placement of strain JF02 according to 16S rRNA gene sequence analysis
The tree was constructed using the neighborjoining method， and genetic distances were computed from Kimuras twoparameter model. Bootstrap values， expressed as percentages of 1 000 replications， are given at branching points. Bar， 0.01 substitutions per nucleotide position.
Fig. 2 Phylogenetic placement of strain JF02 according to gyrB gene sequence analysis
Table 3 Sensitivity of strain JF02 to various chemotherapeutic agents.
Chemotherapeutic agentsDisc concentration∥μgSensitivitya
PenicillinsAmoxicillin10R
Penicillin10R
Ampicillin10S
CephalosporinsCeftriaxone30S
Cefoperazone75S
Cephalothin30S
Cephalosporin30S
Cephazolin 30MS
TetracyclineTetracycline30R
Minocycline30S
Doxycycline30S
MacrolidesAzithromycin15S
SulphonamidesCotrimoxazole3.75MS
Trimethoprim5S
Quinolones andEnrofloxacin10R
FluoroquinolonesOfloxacin5S
Ciprofloxacin10S
Orfloxacin10S
LincosamidesLincomycin2R
Clindamycin2R
AminoglycosideAmikacin30S
Kanamycin30S
Netilmicin30S
Streptomycin10S
Gentamicin10S
Tobramycin10S
GlycopeptideVancomycin30R
Neomycin30S
OthersBacillosporin300MS
Nitrofurantion300S
Rifampicin5S
R， resistant； S， sensitive； MS， moderately sensitive.
Discussion
A strain JF02 was obtained from GIFT with common clinical signs of disease （such as black body， pale or focally necrosis of the gills， scale shedding， fin rot， liver hyperemia， and hydroabdomen） that have been reported in carp and rainbow trout infected by S. putrefaciens[19]. The virulence test showed that JF02 was strongly virulent to GIFT， and the LC50 was 1.41×105 CFU/ml. Besides， the strain JF02 was also detected to have the similar phenotypic characteristics to S. xiamenensis sp. nov. S4T strain[12]. Meanwhile， the 16S rRNA gene sequence of strain JF02 showed the highest similarity with that of S. xiamenensis strain S4. However， since it was found that the 16S rRNA gene can not distinguish between some closely related species， the gyrB gene， which encodes the Bsubunit of DNA gyrase， has been shown to be a suitable molecular marker for the higher nucleic base substitutions[20-21]. Moreover， the gyrB genes are essential and ubiquitous throughout microorganisms and are sufficiently large in size for use in analysis of microbial communities[22]. So， the gyrB gene is used to as the exceptionally molecular marker to evaluate the species. In this study， the 16S rRNA and gyrB of strain JF02 were both similar to those of S. xiamenensis strain S4 （refer to FJ589031 and FJ589040）. Combining with results of biochemical， it can be presumed that the isolated strain JF02 was S. xiamenensis， which was for the first time reported as a pathogen for GIFT. The chemotherapeutic antibiotics tests showed that the strain JF02 was sensitive to most antibiotics as shown in Table.3. Several commonly used antibiotics （such as amoxicillin， penicillin， tetracyclin， lincomycin and clindamycin）， which were used frequently in human medicines[23] and the treatment of bacterial diseases of fish[24]， had not controlled the strain JF02. It means that the strain JF02 has obtained the resistance to many antibiotics due to the longterm abuse of antibiotics in aquaculture. The genus Shewanella may be identified by antibiotic resistance determinants， such as βlactamases and quinolone[25-27]. In this study， the enrofloxacin of quinolones commonly used in aquaculture also failed to challenge this strain. The results showed that the strain JF02 has obtained quinolone resistance， and belongs to the genus Shewanella. These results of antibiotic tests explained why this epidemic disease of GIFT was a common phenomenon in Hainan Province. Remarkably， the strain JF02 has obtained the resistance to vancomycin， which has been used to challenge the methicillin resistant Staphylococcus aureus.
Some studies suggested that several species of genus Shewanella can cause the diseases to human[28-29]. Since we have isolated S. xiamenensis from GIFT in different farms in Hainan Province， it seems that appropriate aquaculture management is essential to avoid the pathogen threat to GIFT and/or the staff of fish farms. Until now， S. xiamenensis has caused increasingly serious threat on human health and aquatic production. It is time to promote awareness of focusing on the research of S. xiamenensis， such as species identification， phylogenetic relationship， epidemiology， pathogenesis and pathology， to prevent the bacteria from damaging human and aquatic production in the future.
References
[1] PULLIN RSV， EKNATH AE， GJEDREM T， et al. The Genetic Improvement of Farmed Tilapias （GIFT） project： the story so far[J]. Naga， 1991， 14： 3-6.
[2] HUANG WM. Bacterial diversity based on type II DNA topoisomerase genes[J]. Annu Rev Genet 1996， 30： 79-107.
[3] Macdonell MT， Colwell RR （1985） Phylogeny of the Vibrionaceae， and Recommendation for Two New Genera， Listonella and Shewanella. Systematic & Applied Microbiology 6：171-182.
[4] RUSSELL NJ， NICHOLS DS. Polyunsaturated fatty acids in marine bacteria——a dogma rewritten[J]. Microbiology， 1999， 145 （ Pt 4）：767-779.
[5] JANDA JM， ABBOTT SL. The genus Shewanella： from the briny depths below to human pathogen[J]. Crit Rev Microbiol， 2014， 40： 293-312.
[6] HOLT HM， GAHRNHANSEN B， BRUUN B. Shewanella algae and Shewanella putrefaciens： clinical and microbiological characteristics[J]. Clin Microbiol Infect， 2005， 11： 347-352.
[7] HAU HH， GRALNICK JA. Ecology and biotechnology of the genus Shewanella[J]. Annu Rev Microbiol， 2007， 61： 237-258.
[8] NOZUE H， HAYASHI T， HASHIMOTO Y， et al. Isolation and characterization of Shewanella alga from human clinical specimens and emendation of the description of S. alga Simidu et al.， 1990， 335[J]. Int J Syst Bacteriol， 1992， 42： 628-634.