Abstract With the total RNA of Dunaliella salina as a template， the cDNA sequence of D. salina small GTP-binding protein gene was amplified by RT-PCR technique， and cloned onto pMDl8-T simple vector， the recon was subjected to PCR detection and restriction endonuclease analysis， and the total sequence of DNA was determined. The results showed that the cloned fragment was 612 bp， and shared 100% homology with reported D. salina DsRab gene （GenBank： JN989548）. The target gene fragment was inserted downstream of pMDCG 35S promoter， constructing subcellular localization recombinant vector pMDCG-DsRab. The successfully constructed subcellular localization recombinant vector pMDCG-DsRab was transformed into Agrobacterium tumefaciens LBA4404， and positive single clones were screened and used for transinfection of onion epidemical cells by Agrobacterium-mediated method， and the instant expression of DsRab was observed under fluorescence microscope. The results showed that the fusion protein GFP-DsRab was successfully expressed in onion epidemical cells， and mainly distributed on cytomembrane. This study will provide reference for further illumination of the function and action mechanism of D. salina small GTP-binding protein DsRab.
　　Key words Dunaliella salina； Small GTP-binding proteins； Subcellular localization； Fusion protein
　　Dunaliella salina belongs to Dunaliella in Dunaliella family of Volvocales in Chlorophyceae of Chlorophyta. D. salina is known as the eucaryon with the highest salt tolerance， which could grow and propagate in 0.05-5.0 mol/L NaCl nutrient solution， and is the most ideal model organism for the study on plant salt tolerance physiology and molecular mechanism[1]. Therefore， some scholars deem that the deep discussion of the molecular mechanism of the adaption of D. salina to high salt concentration is of great significance and has high application value. Over the years， many scholars prove that the rapidly volume change and glycerol metabolism play an important role in the response of D. salina to rapid change of osmotic pressure[2-3]， while the further regulation mechanism of gene expression and the molecular pathway of signal transmission in salt stress is not clear yet.
　　Small GTP-binding protein family is a class of single-subunit proteins， which are common in all eucaryotic cells. There are many members， forming a super protein family with more than 100 members. They are divided to such five subfamilies according to their structures as Ras， Rho， Rab， Sar/Arf and Ran. Their molecular weights are smaller， about 20-30 kD， and in order to distinguish from heterotrimeric G protein， they are called small GTP-binding proteins. Small GTP-binding proteins exist in two forms， i.e.， the activated state （bound with GTP）， and the non-activated state （bound with GDP）. They regulate various signal transmission processes as a molecular switch through the conversion between the activated and non-activated states[4]. Researches show that small GTP-binding proteins widely participate in many physiological processes such as gene expression， cytoskeletal reorganization， vesicular transport and microtubule nucleation， and nuclear pore transport[5-6]. Therefore， the study on the small GTP-binding protein of D. salina is of great scientific significance to the illumination of highly-complex molecular mechanism of cells. 　　In this study， with total RNA of D. salina as a template， D. salina small GTP-binding protein DsRab was obtained by RT-PCR， the subcellular localization vector pMDCG-DsRab was constructed successfully and transformed into onion epidermal cells by Agrobacterium-mediated method， the fusion protein was successfully expressed and correctly localized in onion epidermal cells， and finally， the distribution of small GTP-binding protein DsRab in D. salina cells was made clear. The result will provide reference for further illumination of the molecular mechanism of the adaption of D. salina to high salt environment and the molecular pathway of the response of D. salina to salt stress.
　　Materials and Methods
　　Materials
　　D. salina was provided by the hydrobiological laboratory of Dalian Ocean University. The D. salina nutrient solution was Conwy test solution[7]， and culture was performed at 25 ℃ under 1 250 lx， and 12 h illumination/12 h dark. pMDCG plasmid （containing GFP gene） and Escherichia coli DH5α were preserved in the laboratory. pMDl8-T simple and Agrobacterium tumefaciens LBA4404 Electro-Cells were purchased from TaKaRa company.
　　RNAiso Plus， DNA Marker DL-2000， restriction endonuclease， Taq enzyme， lysosome， IPTG， X-gal， DEPC and Reverse Transcriptase M-MLV （RNase H-） were all purchased from TaKaRa company. The gel recovery kit was purchased from Axygen Biotechnology Co.， Ltd.， and other reagents were all analytically pure， and made in China.
　　Extraction of D. salina total RNA
　　At first， algal cells were collected from 10 ml of D. Salina in logarithmic phase （the nutrient solution contanined （3.0 mol/L NaCl） ， and the total DNA was extracted according to the instruction of RNAiso Plus kit. The DNA quality was detected wtih 1% agarose gel electrophoresis.
　　Construction of D. salina DsRab gene vector for cloning and subcellular localization
　　Primers were designed according to the full-length sequence of cDNA of DsRab gene （GenBank： JN989548）： P1： GCGGATCCATGAACCCAGAGTACGAC （the underlined part is the BamH I cutting site）， and P2： TATCTAGAGCAGCAGGTGGAGCGGTTAT （the underlined part is the Xba I cutting site）. With the cDNA reverse-transcripted by total RNA as a template and P1 and P2 as primers， PCR was performed. The PCR was started with pre-denaturation at 94 ℃ for 5 min， followed by 35 cycles of denatruation at 94 ℃ for 30 s， annuealing at 60 ℃ for 30 s and extenstion at 72 ℃ for 1 min， and completed by extenstion at 72 ℃ for 10 min. The amplification product was separarted by 1.0% garose gel electrophoresis， the target fragment was ligated to pMDl8-T simple vector （T-A coloning）， and the recombinant plasmid pMD18-DsRab was constructed. The constructed plasmid was transformed into competent E. coli. DH5. Postive colones were screened on Amp+ resistant plate， and identified by PCR and digestion. The target fragment and the expression vector pMDCG （carrying GFP gene） were subjected to digestion with BamH I and Xba I， and the target fragement and large vector fragement were recovered and subjected to ligation with T4 ligase， construcing recombinant exopression vector pMDCG-DsRab for subcellular localization. The vector was transformed into competent E. coli. DH5α， and single positive clones were screened， and transported to Takara Biotechnology （Dalian） Co. Ltd.， to verify the correctness of the reading frame. 　　Transformation of recombinant plasmid to A. tumefaciens LBA4404 and the transfection of onion epidermal cells
　　The sequenced correct subcellular localization expression plasmid pMDCG-DsRab and plasmid pMDCG were transformed into A. tumefaciens LBA4404 by electric shock transformation method. The single colony of LBA4404 identified to be correct was picked and inoculated to 10 ml of YEP liquid medium. The inoculated liquid was cultured at 30 ℃ overnight with oscillation. Then， 3-4 ml of the bacterial liquid was inoculated to 50 ml of YEP liquid medium （50 μg/ml Amp， 100 μmol/L AS）， and cultured at 30 ℃ with oscillation to OD600=0.6-0.7. Centrifugation was performed to collect the bacteria， which were suspended with MS liquid medium （10 mmol/L MgCl2， 100 μmol/L AS） to OD600=1.0. Onion epidermal cells were pre-cultured at 24 h （25 ℃， 14/10 h）， and then immersed in the bacterial suspension （10 m mol/L MgCl2， 100 μmol/L AS）， for 20-30 min. Next， the bacterial suspension was absorbed with filter paper， and the onion epidermal cells were flatly laid on MS solid medium （100 μmol/L AS） and co-cultured with the bacteria for 24 h （25℃， 16 h/8 h）. The onion epidermal cells were taken out and washed with MS liquid medium to remove the LBA4404 adhered on the surface. Mounting was performed， and the obtained section was observed under fluorescence confocal microscope.
　　Results and Analysis
　　Cloning of D. salina DsRab gene
　　With the total RNA of D. salina as template， PCR amplification was performed according to above method， and the PCR product was detected by 1% agarose gel electrophoresis （Fig. 1-A）. As shown in Fig. 1-A， a clear band at about 600 bp was observed， which was consistent with the expected sequence. The recombinant plasmid pMD18-T Simpie-DsRab was subjected to double enzyme digestion and PCR detection， and the result （Fig. 1-B） showed that the target fragment had been ligated to the cloning vector pMDl8-T simple. The sequencing result of the recombinant plasmid was aligned with the target gene sequence， and found to be completely consistent with the DsRab open reading frame， indicating that the recombinant plasmid pMD18-T Simpie-DsRab was constructed successfully.
　　Construction of D. salina DsRab gene subcellular localization vector and genetic transformation with A. tumefaciens LBA4404
　　The cloning vector pMD18-T Simpie-DsRab identified to be correct and the eukaryotic expression vector pMDCG were subjected to digestion with BamH I and Xba I and ligation with T4 ligase， construcing recombinant exopression vector pMDCG-DsRab for subcellular localization. The vector was transformed into competent E. coli. DH5α， and single positive clones were screened. The result obtained throught digestion with BamHⅠand Xba I and PCR detection of the plasmid （Fig. 2） showed that the size of the targe fragement was consistent with the anticiplated size， indicating that the target fragement had been correctly ligated with the subcellular localization vector. The recombinant plasmid was used for sequencing. The sequencing result was completely consistent with the DsRab （GenBank：JN989548） open reading frame， indicating that the recombinant plasmid pMDCG-DsRab was constructed successfully. With the indentified recombinant plasmid pMDCG-DsRab as positive control and sterile water and A. tumefaciens LBA4404 as negative control， clonial PCR detection was performed. The result （Fig. 3） showed that the A. tumefaciens LBA4404 containing the recombinant plasmid had one obvious band at about 600 bp， at the same position to the band in the positive control， while the negative control did not show the band. It indicated that the recombinant plamid had been successfually transformed to A. tumefaciens LBA4404. 　　Subcellular localization of D. salina DsRab protein
　　In order to determine the specific location where the protein expressed by D. salina DsRab gene plays its role， the fusion expression vector of green fluorescent protein and DsRab gene was constructed， and transformed into onion epidermal cells by Agrobacterium-mediated method， achieving efficient transient expression. The control was the onion epidermal cells infected with A. tumefaciens LBA4404， and no fluorescence signal was observed from it （Fig. 4-A）. The Agrobacterium-infected epidermal cells transformed with vacant pMDCG vector （containing GFP） showed clear GFP green fluorescence signal in whole cells （Fig. 4-B） due to that the GFP protein has no positioning function. In the epidermal cells infected with A. tumefaciens LBA4404 transformed with pMDCG-DsRab， only very strong fluorescence was observed on cytomembrane （Fig. 4-C）. It was indicated that D. salina DsRab protein was successfully expressed in onion epidermal cells and mainly distributed on cytomembrane.
　　Discussion
　　The subcellular localization of gene expression product is a kind of important information in proteomics， as well as an important content in functional genomics. It is an obbligato link in the understanding of the formation of plant morphology， growth and development and tolerance and resistance to stress， as well as one hotspot in biological research.
　　At present， subcellular localization of plant protein adopts fusion reporter gene method. Green fluorescent protein （GFP） as a reporter gene has many advantages such as no need for cofactors， stable fluorescent property， small molecular weight， no toxicity to cells and allowance of living cell observation， and could be used for intuitive observation as well as quantitative determination. It has been widely applied to transgenosis， protein interaction， drug screening and signal transduction[10-11]. In this study， according to the detection results of fluorescence microscope， the cytomembrane part of onion epidermal cells emitted green fluorescence， indicating that DsRab：： GFP was expressed in onion epidermal cells， correct localization of D. salina DsRabin was realized in cells， and the green fluorescence was emitted by the fusion protein DsRab：： GFP. Therefore， D. salina DsRabin protein was localized in cytomembrane. The amino acid sequence of DsRab protein was analyzed by bioinformatics. The sequence analysis showed that the small GTP-binding protein was very conservative in evolution， and the amino acid sequence of the protein showed the similarity reaching 76%-86% with the amino acids of small GTP-binding protein Rab subfamily of other species， and had the conservative domain of small GTP-binding proteins and the common domain of Rab subfamily. The N terminal and C terminal of the protein sequences of Rab subfamily are highly variable， but they all have the cysteine domain C/CC/CXC or CXXX （X represents any amino acid） at the C terminal[12-14]. This domain is a kind of membrane localization signal， when the cysteine in it is subjected to isoprenylation modification， the Rab protein is endowed with hydrophobicity and has its C termination connected with membrane， while the N terminal might participate in the guiding of the isoprenylation modification of the cysteine at the C terminal[15]. The C terminal of the amino acid sequence of the D. salina DsRab protein obtained in this study was CC， and the subcellular localization prediction result was in accordance with the localization result of the fusion protein. 　　Researches show that Rab subfamily proteins is related to plant stress resistance[16]. Plants change the activity of some enzymes and regulate gene expression to adapt to and resist high-salt and drought stresses. During the process， the most important link is the activation of signal transduction proteins， and the small GTP-binding protein is a class of the signal transduction proteins[17]. Figueras et al.[18] reported that the overexpression of maize rab17 gene in Arabidopsis thaliana improved the tolerance of A. thaliana to salt and accelerated the recovery after mannitol treatment. There are also studies reporting that the expression level of Rab protein gene increased rapidly both in ordinary wheatgrass in the early period of salt stress[19] and wheat leaf cells in the early period of Puccinia triticina infection[20]. Kwon et al.[21] reported that the transcription level of RabG3b gene in A. thaliana was also remarkably improved under various stresses such as high salt， high osmotic pressure， low temperature， pathological reaction and aging process. The research team also analyzed the expression of DsRab gene under high-salt stress， and found that the gene was expressed in the response to salt stress， and its expression level was improved to 4.9 times of the control group at 1 h after salt stress， which is similar to the stress response of DsRab gene in most plants. The response of DsRab gene to salt stress indicates that it might be closely related to the high salt tolerance in D. salina[22]. However， the obtaining of D. salina DsRab gene and its preliminary function analysis are just a beginning， and the subsequent work is to screen the protein interacting with DsRab by co-immunoprecipitation， so as to lay a foundation for the illumination of D. salina small GTP-binding protein DsRab and its action mechanism.
　　References
　　[1] WANG TY， JING CQ， DONG WH， et al. Nucleotide sequence and expression of the 14-3-3 from the halotolerant alga Dunaliella salina[J]. Molecular Biology Reports， 2010，37（2）：1099-1103.
　　[2] CHEN H， LAO YM， JIANG JG. Effects of salinities on the gene expression of a （NAD（+））-dependent glycerol-3-phosphate dehydrogenase in Dunaliella salina[J]. Sci Total Environ， 2011， 409（7）： 1291-1297.
　　[3] JIA YL， XUE LX， LIU HT， et al. Characterization of the glyceraldehyde-3-phosphate dehydrogenase （GAPDH） gene from the halotolerant alga Dunaliella salina and inhibition of its expression by RNAi[J]. Current Microbiology， 2009，58（5）：426-431. 　　[4] TAKAI Y， SASAKI T， MATOZAKI T. Small GTP-binding proteins[J]. Physiol Rev， 2001， 81（1）： 153-208.
　　[5] ZHANG ZW， ZHAO J， FAN MS， et al. Advances in research on plant small GTP-binding protein[J]. Acta Botanica Boreali-Occidentalia Sinica， 2009， 29（3）： 0622-0628. （in Chinese）
　　[6] HUTAGALUNG AH， NOVICK PJ. Role of Rab GTPases in Membrane Traffic and Cell Physiology[J]. Physiol Rev 2011， 91： 119–149.
　　[7] Chen my. Living food culture[M]. Beijing： China Agriculture Press， 1995. （in Chinese）
　　[8] LEI G ， QIAO DR， BAI LH， et al. Isolation and characterization of a mitogen-activated protein kinase gene in the halotolerant alga Dunaliella salina[J]. Journal of Applied Phycology.2008，20（1）：13-17.
　　[9] LIVAK KJ， SCHMITTGEN TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2（-Delta Delta C（T）） Method.Methods. 2001， 25（4）： 402-408.
　　[10] PRASHER DC， ECKENRODE VK， Ward WW， et al. Primary structure of the Aequoria Victoria green-fluorescent protein.Gene，1992，111：229-233.
　　[11] CHALFIE M， TU Y， EUSKIRCHEN G， et al. Green fluorescent protein as a marker for gene expression.Science，1994，263：802-805.
　　[12] GAO W， TIAN ZD， LIU J， et al. Isolation， characterization and functional analysis of StRab， a cDNA clone from potato encoding a small GTP-binding protein[J]. Scientia Horticulturae， 2012，135：80–86.
　　[13] NAGANO Y， MURAI N， MATSUNO R， et al. Isolation and characterization of cDNAs that encode eleven small GTP-binding proteins from Pisum stivum[J]. Plant Cell Physiol， 1993， 34（3）： 447-455.
　　[14] YANG Z. Small GTPase： versatile signaling switches in plants[J]. Plant Cell， 2002， 14： S375-S388.
　　[15] SZUMLANSKI AL， NIELSEN E. The Rab GTPase RabA4d regulates pollen tube tip growth in Arabidopsis thaliana [J]. The Plant Cell， 2009， 21：526-544.
　　[16] MAZEL A， LESHEM Y， TIWARI BS， et al. Induction of salt and osmotic stress tolerance by overexpression of an intracellular vesicle trafficking protein AtRab7（AtRabG3e）[J] .Plant Physiology ，2004， 134： 118–128.
　　[17] GUO ZA， ZANG QW， JING XL， et al. Isolation and expression analysis of small GTP-binding protein gene TaRab2 in wheat[J]. Acta Agronomica Sinica， 2005， 33（2）： 201-207. （in Chinese）
　　[18] FIGUERAS M， PUJAL J， SALEH A， et al. Maite Rab17 overexpression in Arabidopsis plants promotes osmotic stress tolerance[J]. Annals of Applied Biology， 2004， 144： 251-257
　　[19] BORG S， BRANDSTRUP B，JENSSEN TJ， et al.Identification of new protein species among 33 different small GTP binding proteins encoded by cDNA from Lotus japonicas and expression of corresponding mRNAs in deveping root nodules[J]. Plant J， 1997， 11（2）： 237-250
　　[20] YANG JJ， LI X， LI YN， et al. Involvement of small GTP-binding protein gene Rab2 in resistance response of wheat to its leaf rust disease[J]. Acta Agriculturae Boreali-Sinica， 2010， 25（4）：1-5. （in Chinese）
　　[21] KWON SI， CHO HJ， BAE K， et al. Role of an Arabidopsis Rab GTPase RabG3b in pathogen response and leaf senescence[J]. Plant Biol 2009， 52（3）： 79-87
　　[22] SHE ZJ， CHAI XJ， ZHANG XL， et al. Cloning and expression analysis of small GTP-binding protein gene from Dunaliella salina （DsRab） under salt stress[J]. Biotechnology Bulletin， 2013， （9）： 77-83. （in Chinese）