Abstract Nervous necrosis virus （NNV） is the causative agent of fulminant infectious diseases in marine fishes such as grouper. Specific primers were designed based on the conserved sequence of capsid protein （CP） gene of redspotted grouper nervous necrosis virus （NNV）. By optimizing the reaction conditions， a rapid and simple reverse transcription loopmediated isothermal amplification （RTLAMP） method was established for NNV detection. After adding SYTO9 fluorescent dye in the reaction system， the amplification curve was monitored in real time using a fluorescence detector， and the result was obviously easy to assess. Moreover， the specificity and sensitivity of the established method was analyzed. The results showed that the established RTLAMP method has good specificity with a detection limit of 1.3 pg/μl. The detection sensitivity of the established RTLAMP method is 100 times that of the conventional RTPCR method， and the detection duration is only 40 min. The established RTLAMP method is suitable for quarantine and rapid detection of grouper nervous necrosis virus.
　　Key words Grouper； Nervous necrosis virus； Capsid protein gene； Realtime fluorescent RTLAMP
　　Fish viral nervous necrosis （VNN）， also known as viral encephalopathy and retinopathy （VER）， is a devastating disease caused by nervous necrosis virus （NNV）， which causes serious harm to marine fish breeding and results in an extremely high mortality rate at fry stage. So far， VNN outbreaks have been reported in about 40 marine fish species in many countries and regions[1-3]. At present， VNN has been listed as one of the important fish diseases by OIE （Office International des épizooties） due to its strong infectivity and great harm[1]. NNV belongs to the genus Betanodavirus of family Nodaviridae， which is a small RNA virus consisting of two singlestranded RNA strands （RNA1 and RNA2）[2]. Specifically， RNA1 is a nonstructural protein of the virus that encodes RNAdependent RNA polymerase （RdRp）， whereas RNA2 encodes the viral coat protein[2， 4-5]. In recent years， outbreaks of epidemic viral nervous necrosis of various grouper species have been frequently observed in many southern provinces of China. Larvae and juveniles are susceptible to VNN and the mortality rate can be up to 60% to 100%， causing huge economic losses to the grouper breeding industry[6-8]. Due to the lack of effective drugs and vaccines， the spread of NNV can only be prevented by timely detection and comprehensive prevention. Therefore， the establishment of a simple， rapid， highsensitivity and strongspecificity method for detection of NNV in grouper is particularly important for preventing and controlling VNN. 　　At present， many methods have been used at home and abroad to detect NNV in grouper， including cell culture， immunohistochemistry， fluorescent antibody technique， enzymelinked immunosorbent （ELSA）， reverse transcriptase polymerase chain reaction （RTPCR） and realtime quantitative PCR[7-11]. ELSA technique has been applied for early detection and diagnosis of NNV[10-11]， but it is rarely used due to low sensitivity and lack of stability. Currently， RTPCR and nested RTPCR are commonly used detection methods at home and abroad， which can be used to detect various NNV genotypes due to simple operations and good stability[7， 12-13]. Moreover， methods with high sensitivity can detect the template with 200 copies[13]. Fluorescent quantitative RTPCR， which is developed on the basis of RTPCR technique， can be used for realtime monitoring of the entire PCR process via fluorescence signal accumulation， resulting in accurate quantization[8， 14-16]. However， these methods are not suitable for onsite batch rapid detection due to tedious operation procedures， long timeconsuming， low specificity or expensive detection instruments. Loopmediated isothermal amplification （LAMP） is a novel nucleic acid amplification technique that designs two pairs of specific primers based on six specific sites of the target gene， by which the target sequence can be amplified rapidly， specifically and sensitively without hightemperature denaturation under the catalysis of DNA polymerase （Bst DNA polymerase） with chain replacement activity[17-18].
　　Reverse transcription loopmediated isothermal amplification （RTLAMP） is a simple， rapid， efficient and economical technique that allows onestep amplification of the RNA template by adding reverse transcriptase to the LAMP reaction system， of which products could be detected by using turbidimeter， gel electrophoresis apparatus and realtime fluorescence curve detector. Especially， fluorescent LAMP technique can lead to visualized results， which is particularly suitable for detection and diagnosis of diseases in primary laboratories or on site. In recent years， it has been well applied in the detection of viral pathogens in fishes， such as rhabdovirus， iridovirus， viral hemorrhagic septicemia virus （VHSV） and reovirus[19-22]， which is also suitable for NNV detection[23-27].
　　In this study， specific primers were designed with capsid protein （CP） gene of redspotted grouper nervous necrosis virus （RGNNV） as the target sequence. By detecting the realtime fluorescence curve， a rapid realtime fluorescent RTLAMP detection and diagnostic method was established for grouper nervous necrosis virus. In addition， 50 suspected NNV samples were collected from Wenchang and Qionghai in Hainan to conduct a comparative test by RTPCR and RTLAMP techniques， aiming at providing technical means for early diagnosis and timely prevention and control of VNN. 　　Materials and Methods
　　Materials
　　Experimental materials
　　Fifty pearl gentian grouper juveniles （about 3-5 cm in length） with suspected VNN infection and five healthy individuals were collected from two grouper nurseries in Wenchang and Qionghai， Hainan Province. The collected grouper juveniles were transported to the laboratory under low temperature conditions，and their kidney， spleen and brain tissues were then sampled and stored at -80 ℃ before use.
　　NNV， VHSV， infectious haematopoietic necrosis virus （IHNV） and red sea bream iridovirus （RSIV） were preserved in the laboratory.
　　Reagents and instruments
　　Reverse transcriptase AMV， DNA molecular weight standard （DL2000）， TaKaRa MiniBEST Viral RNA/DNA Extraction Kit， dNTPs and PrimeScript One Step RTPCR Kit Ver.2 were purchased from Takara Biotechnoligy （Dalian） Co.， Ltd.； Bst DNA polymerase was produced by NEB Corporation； Betaine and MgSO4 were produced by Sangon Biotech （Shanghai） Co.， Ltd.； saturated fluorescent dye SYTO9 （5 mmol/L） was produced by Invitrogen Corporation. Refrigerated centrifuge （Eppendorf）， ZYDS1 constanttemperature fluorescence detector and electrophresis apparatus were all domestically produced.
　　Methods
　　Extraction of viral RNA
　　The kidney， spleen and brain tissues of grouper were mixed and homogenized. In accordance with the introduction of TaKaRa MiniBEST Viral RNA/DNA Extraction Kit， total RNA was extracted from 100 mg of samples and stored at -80 ℃ before use. RNA concentration was determined by a spectrophotometer.
　　Primer design and synthesis
　　By using LAMP primer designing software Primer explorer V4， four specific primers were designed based on the ORF nucleotide sequences that encode CP gene （GenBank accession number： AY601879） of red spotted grouper nervous necrosis virus， including forward inner primer （FIP）， backward inner primer （BIP）， forward outer primer （F3）， and backward outer primer （B3）. The primers were synthesized by Sangon Biotech （Shanghai） Co.， Ltd. The primer sequences were shown in Table 1.
　　Optimization of RTLAMP reaction system
　　In accordance with the method proposed by Xu et al.[24]， RTLAMP reaction system was designed， which consisted of 0.2 μmol/L NNVCPF3， 0.2 μmol/L NNVCPB3， 1.6 μmol/L NNVCPFIP， 1.6 μmol/L NNVCPBIP， 1.3 mmol/L dNTP mix， 0.8 mol/L Betaine， 8 mmol/L MgSO4， 8 U of Bst DNA polymerase， 2.5 μl of 10 × ThermoPol Buffer， 1 U of AMV reverse transcriptase， 0.25 μmol/L SYTO9， and 2 μl of RNA template； the mixture was added with ultrapure water to a final volume of 25 μl and fully mixed for RTLAMP using ZYDS1 constanttemperature fluorescence detector within the temperature range of 59-65℃. The fluorescence signals were monitored in real time. Typical Sshaped amplification curves indicated positive results. 　　Different concentrations of Mg2+， dNTPs， inner primers and outer primers were selected to evaluate their effect on RTLAMP amplification. The concentration of Mg2+ ranged between 2-16 mmol/L； the concentration of dNTPs ranged between 0.5-1.6 mmol/L； the ratio of inner primer to outer primer ranged between 1：（1-10）. On the basis of the optimized concentrations of different components， RTLAMP was performed at 59， 60， 61， 62， 63， 64 and 65℃ to determine the optimal reaction temperature. The fluorescence signals were monitored in real time to determine the optimal reaction duration.
　　Specificity assay
　　The RTLAMP method established in this study was used to simultaneously detect NNV， VHSV， IHNV and RSIV. Double distilled water was used as a blank control to analyze the specificity of the detection method.
　　Sensitivity assay
　　The concentration of the extracted total RNA was determined by a nucleic acid analyzer. The extracted total RNA was diluted 10fold （10-1-10-6）. A 2 μl aliquot of each dilution was used as a template for detection and comparison with the conventional RTPCR method and the established RTLAMP method.
　　The conventional RTPCR was performed with the standard detection method recommended by OIE[1]. Forward primer： 5′CGTGTCAGTCATGTGTCGCT3′； reverse primer： 5′CGAGTCAACACGGGTGAAGA3′. NNV capsid protein gene RNA2 was amplified. The amplification product was 421 bp in length.
　　Rapid detection of grouper NNV by RTLAMP
　　Fifty pearl gentian grouper samples with suspected VNN infection and five healthy samples， which were collected from two grouper nurseries in Wenchang and Qionghai， Hainan Province， were detected with the established RTLAMP method and RTPCR method. The detection results were compared by using NNV RNA and water as positive control and blank control， respectively.
　　Results and Analysis
　　Establishment of RTLAMP reaction system
　　By optimizing the reaction conditions， the optimal concentration of each component in RTLAMP reaction system was determined： 0.2 μmol/L NNVCPF3， 0.2 μmol/L NNVCPB3， 1.4 μmol/L NNVCPFIP， 1.4 μmol/L NNVCPBIP， 1.3 mmol/L dNTP mix， 0.8 mol/L Betaine， 6 mmol/L MgSO4， 8 U of Bst DNA polymerase， 2.5 μl of 10 × ThermoPol Buffer， 1 U of AMV reverse transcriptase， 0.25μmol/L SYTO9， and 2 μl of RNA template. The optimal reaction temperature and duration were 63 ℃ and 40 min， respectively. The detection result was shown in Fig. 1.
　　Agricultural Biotechnology2018 　　Results of specificity and sensitivity assays
　　In specificity assay， NNV， VHSV， IHNV and RSIV were detected simultaneously by the established RTLAMP method. According to the results， NNV RNA sample showed the typical Sshaped amplification curve， whereas other samples and blank control showed no Sshaped curve， indicating that the established method had relatively strong specificity.
　　In sensitivity assay， the extracted total RNA was diluted 10fold （10-1-10-6）. Each dilution was detected by the established fluorescent RTLAMP method and conventional RTPCR method. According to the results， detection sensitivity of the established fluorescent RTLAMP method was 10-5 （Fig. 2）， which corresponded to 1.3 pg/μl total RNA. However， with the conventional RTPCR method， a weak target band could be observed at a 10-3 dilution （Fig. 3）， suggesting that the sensitivity was only 10-3. The sensitivity of RTLAMP method was 100 times that of RTPCR method.
　　Rapid detection of grouper NNV by RTLAMP
　　Fifty pearl gentian grouper samples with suspected VNN infection and five healthy samples， which were collected from two grouper nurseries in Wenchang and Qionghai， Hainan Province， were detected with the established RTLAMP method and RTPCR method to compare the detection results between RTLAMP and RTPCR. By RTLAMP method， 39 positive samples and 11 negative samples were detected among 50 samples with suspected VNN infection. By RTPCR method， 36 positive samples and 14 negative samples were detected. As could be seen in Table 2， positive rate of RTLAMP method （78.4%） was slightly higher than that of RTPCR （72.5%）. However， blank control and five healthy samples were undetected by two methods. The detection process met the requirements of quality control. By RTLAMP method， the detection duration was about 1 h. By RTPCR method， the detection duration was 5-6 h. Moreover， RTLAMP method was simple and the result was easy to assess. Therefore， RTLAMP technique significantly improves the detection efficiency. The detection results of 50 randomly collected samples by RTLAMP and RTPCR were shown in Table 2.
　　Discussion
　　Fish viral nervous necrosis （VNN）， caused by nervous necrosis virus （NNV）， is one of the common diseases of cultured marine fishes， which mainly infects larvae and juveniles. Fish juveniles infected with VNN are characterized by black skin， inability to swim and spinning on the surface of water. The cumulative mortality rate is up to 100%. Thus， VNN has become the biggest obstacle to the breeding of groupers， causing great economic losses to the breeding industry. NNV can not only spread horizontally through contaminated water bodies， baits or infected individuals， but also spread vertically from broodstock to offspring， resulting in largescale infections of VNN in groupers throughout the whole pool or in the culture area. There are reports of VNN outbreaks in many regions in Asia， Europe and North America[2-3， 5， 7]. In China， Hainan， Guangdong， Fujian and Taiwan are highincidence areas[6-8]. In addition， VNN is mainly harmful to the breeding of grouper juveniles. 　　In order to effectively prevent and control VNN， reduce losses and ensure the healthy development of grouper breeding industry， it is necessary to establish a simple and rapid detection method for early diagnosis of NNV infection. At present， RTPCR[7，12-13]or fluorescent quantitative RTPCR[15-16]has become the most commonly used detection method at home and abroad. Specifically， fluorescent quantitative RTPCR method exhibits higher sensitivity， which can be used to detect 10 copies/μl RNA template （virus） [16]. However， these detection methods require relatively expensive instruments and long detection duration of about 4-6 h. Loopmediated isothermal amplification （LAMP） is an isothermal nucleic acid amplification technique based on strand displacement that not only simplifies the amplification process without initial denaturation and temperaturechanging processes， but also avoids the timeconsuming process of repeated heating and cooling， which is usually completed within 1-2 h. In recent years， it has been applied to the detection of grouper nervous necrosis virus. Sung et al.[23]designed specific primers based on capsid protein gene of grouper nervous necrosis virus and established an RTLAMP method by which the detection requires only 60 min at 65 ℃， with a detection limit of 10-6 NNVRNA. Xu et al.[24]established an RTLAMP detection method and analyzed the amplification products by agarose gel electrophoresis and nucleic acid dyes. The sensitivity and specificity of detection have been improved. Especially， the detection sensitivity was 100 times higher than that of nested RTPCR. However， it is difficult to distinguish negative results and weakly positive results by nucleic acid dyes with naked eyes， and the amplification products easily smear during agarose gel electrophoresis or dye addition， resulting in false positives in subsequent detection[23-24]. In accordance with the LAMP method proposed by Xu et al.[24]with slight modifications， Mekata et al.[25]established an RTLAMP method for detecting redspotted grouper nervous necrosis virus （RGNNV）. Combined with fluorescence quantitative detection， the amplification products were analyzed without opening the cover， which avoids the diffusion of amplification products， leading to more accurate and reliable subsequent detection results. The detection sensitivity is 100 times higher than that of conventional RTPCR. Su et al.[26]established a crossprimer isothermal amplification system for RGNNV detection. The detection results were displayed by tangential flow test strip colorimetry. The detection limit of the established method reached 101 copies/μl RNA template， and the sensitivity was similar to that of fluorescence quantitative RTPCR[26]. 　　In the present study， using the capsid protein （CP） gene of red spotted grouper nervous necrosis virus as the target gene， LAMP primers were designed based on the 454-627 bp conserved region. A realtime fluorescent isothermal amplification system was established. Saturated fluorescent dye SYTO9 was added into the system before the reaction. The fluorescence signals of the amplification products were collected using a fluorescence detector. Moreover， main factors affecting the RTLAMP reaction were optimized， including Mg2+， dNTPs， amplification temperature， amplification duration and the concentration ratio of inner primer to outer primer. The concentration of Mg2+ affects the annealing of primers and the activity of DNA polymerase[24]. In this study， when Mg2+ concentration reached 6.0 mmol/L， the amplification products presented a clear and complete “S” curve earlier. The concentration of dNTPs was related to the specificity of amplification with DNA polymerase[24]. In this study， when the concentration of dNTPs reached 1.3 mmol/L， the amplification products presented a clear “S” curve earlier. The concentration ratio of inner primer to outer primer was related to the sensitivity of the LAMP reaction[24]. The main role of outer primer is to initiate the LAMP reaction， while the concentration of inner primer plays the decisive role. Therefore， one the basis of certain outer primer concentration， different concentration gradients of inner and outer primers were designed. The results showed that the amplification efficiency reached the highest level when the ratio was 1：7， resulting in clearer realtime spectrum. On the basis of optimized amount of each component， the experiment was conducted under different temperature conditions. According to the results， when the temperature reached 63 ℃， a clear and complete "S" fluorescence curve could be detected within 40 min， indicating that the optimal reaction temperature and duration were 63 ℃ and 40 min， respectively. In this study， RTLAMP products were monitored in real time by using fluorescence monitoring system and saturated fluorescent dye SYTO9. The accumulation of fluorescence signals was completely synchronized with the formation of RTLAMP products. The results could be assessed based on whether an Sshaped amplification curve was observed. The established method is more objective and reliable than the methods proposed by Sung et al.[23]and Xu et al.[24]which require addition of a fluorescent dye or gel electrophoresis. It is also simpler and easier to operate than the method established by Mekata et al.[25]. In addition， the detection sensitivity is 100 times higher than that of RTPCR and similar to the method established by Xu et al.[24]. The detection duration （40 min） is much shorter than that of Mekata et al.[25]and Xu et al.[24]. The established method exhibits strong specificity and has no cross reaction with viral hemorrhagic septicemia virus （VHSV）， infectious haematopoietic necrosis virus （IHNV） and red sea bream iridovirus （RSIV）. Furthermore， the realtime fluorescent RTLAMP method established in the present study is not easy to form aerosol contamination， thus avoiding false positives and meeting the rapid and accurate diagnostic requirements for disease detection. 　　In this study， 50 pearl gentian grouper samples with suspected VNN infection and five healthy samples， which were collected from Wenchang and Qionghai， Hainan Province， were detected with the established RTLAMP method and RTPCR method. As could be seen in Table 2， 39 positive samples and 11 negative samples were detected among 50 samples with suspected VNN infection by RTLAMP method， resulting in a positive detection rate of 78.4%， which was slightly higher than that of RTPCR method （72.5%）. However， blank control and five healthy samples were undetected by two methods， indicating that the detection process meets the requirements of quality control and guarantees the possibility of eliminating false positives and false negatives.
　　References
　　[1]
　　OIE Fish Diseases Commission. Diagnostic Manual for Aquatic Animal Diseases[M]. Edition 3rd. Beijing： China Agriculture Press， 2001：165-171.（in Chinese）
　　[2]Munday BL， Kwang J， Moody N. Betanodavirus infections of teleost fish： A review[J]. Journal of Fish Diseases， 2002， 25：127-142.
　　[3]Nakai T， Mori K， Sugaya T， et al. Current knowledge on Viral nervous necrosis （VNN） and its causative betanodaviruses[J]. Isr J AquacultBamid， 2009， 61（3）：198-207.
　　[4]Ball LA. Requirements for the selfdirected replication of flock house virus RNA1[J]. Journal of Virology， 1995， 69（2）：720-727.
　　[5]Nakai T， Nishizawa T. Sequence of the non–structural protein gene encoded by RNA1 of striped jack nervous necrosis virus[J]. Journal of General Virology， 1999， 80：3019-3022.
　　[6]CHEN XY， HUANG JN， LYU N， et al. Cloning and sequence analysis of the coat protein gene of nervous necrosis virus in Epinephelus coioides[J]. Journal of Fisheries of China， 2004， 28（2）：183-188.（in Chinese）
　　[7]CHEN XZ， SU YL， GONG YQ， et al. Detection of nervous necrosis virus from five cultured groupers （Epinephelus spp.） using RTPCR[J]. Journal of Fishery Sciences of China， 2004， 11（3）：202-207.（in Chinese）
　　[8]CHEN XZ， GONG YQ， WANG J， et al. Detection of cultured grouper viral nervous necrosis by realtime fluorescence quantitative RTPCR[J]. Chinese High Technology Letters， 2006， 16（4）：431-434.（in Chinese）
　　[9]Chi SC， Lo BJ， Lin SC. Characterization of grouper nervous necrosis virus （GNNV）[J]. Journal of Fish Diseases， 2001， 24：3-13.
　　[10]Arimoto M， Mushiake K， Mizuta Y， et al. Detection of striped jack nervous necrosis virus （SJNNV） by enzymelinked immunosorbent assay （ELISA）[J]. Fish Pathology （Japan）， 1992， 27（4）：191-195. 　　[11]Huang B， Tang C， Chang SF， et al. Detection of nodavirus in barramundi， Lates calcarifer， using recombinant coat proteinbased ELISA and RTPCR[J]. J Fish Dis， 2001， 24：135-141.
　　[12]Dalla VL， Zanella L， Patarnello P， et al. Development of a sensitive diagnostic assay for fish nervous necrosis virus based on RT‐PCR plus nested PCR[J]. Journal of Fish Diseases， 2010， 23（5）：321-327.
　　[13]Mu Y， Lin K， Chen X， et al. Diagnosis of nervous necrosis virus in orangespotted grouper， Epinephelus coioides， by a rapid and convenient RTPCR method[J]. Acta Oceanologica Sinica， 2013， 32（10）：88-92.
　　[14]Dalla VL， Toffolo V， Lamprecht M， et al. Development of a sensitive and quantitative diagnostic assay for fish nervous necrosis virus based on twotarget realtime PCR[J]. Veterinary Microbiology， 2005， 110（3-4）：167-179.
　　[15]Mazelet L， Dietrich J， Rolland JL. New RTqPCR assay for viral nervous necrosis virus detection in sea bass， Dicentrarchus labrax （L.）： Application and limits for hatcheries sanitary control[J]. Fish & Shellfish Immunology， 2011， 30（1）：27-32.
　　[16]PENG ZF. Research of realtime quantitative RTPCR detected Epinephelus lanceolatus grouper nervous necrosis virus[J]. Journal of Animal Husbandry and Veterinary Medicine Fujian， 2015（1）：15-18.（in Chinese）
　　[17]Notomi T， Okayama H， Masubuchi H， et al. Loopmediated isothermal amplification of DNA[J]. NucIeic Acids Research， 2000， 28（12）：28-63.
　　[18]Nagamine K， Hase T， Notomi T. Accelerated reaction by loopmediated isothermal amplification using loop primers[J]. Mol Cell Probes， 2002， 16：223-229.
　　[19]Liu Z， Teng Y， Xie X， et al. Development and evaluation of a onestep loopmediated isothermal amplification for detection of spring viraemia of carp virus[J]. Journal of Applied Microbiology， 2008， 105（4）：1220-1226.
　　[20]Soliman H， ElMatbouli M. Reverse transcription loopmediated isothermal amplification （RTLAMP） for rapid detection of viral hemorrhagic septicaemia virus （VHS）[J].Veterinary Microbiology， 2006， 114（3/4）：205-213.
　　[21]Caipang CM， Haraguchi I， Ohira T， et al. Rapid detection of a fish iridovirus using loopmediated isothermal amplification （LAMP）[J]. Journal of Virological Methods， 2004， 121（2）：155-161.
　　[22]ZHANG JF， ZENG LB， ZHANG H， et al. Establishment of RTLAMP for rapid detection of grass carp reovirus[J]. Journal of Fishery Sciences of China， 2013， 20（1）： 129-136.（in Chinese）
　　[23]Sung CH， Lu JK. Reverse transcription loopmediated isothermal amplification for rapid and sensitive detection of nervous necrosis virus in groupers[J]. Journal of Virological Methods， 2009， 159（2）：206-210.
　　[24]Xu HD， Feng J， Guo ZX， et al. Detection of redspotted grouper nervous necrosis virus by loopmediated isothermal amplification[J]. Journal of Virological Methods， 2010， 163（2）：123-128.
　　[25]Mekata T， Satoh J， Inada M， et al. Development of simple， rapid and sensitive detection assay for grouper nervous necrosis virus using realtime loopmediated isothermal amplification[J]. Journal of Fish Disease， 2015， 38（10）：873-879.
　　[26]SU ZD. The establishment and application of onsite and rapid detection methods for redspotted grouper nervous necrosis virus[D]. Shanghai： Shanghai Ocean University， 2015.（in Chinese）
　　[27]LIU B， LIU XF， CENG L， et al. Establishment and Application of loopnediated isothermal amplification for fast detection of sevenband grouper nervous necrosis virous[J]. Tianjin Agricultural Sciences， 2016， 22 （7）：23-28.（in Chinese）
　　Editor： Chunmei WU Proofreader： Xinxiu ZHU