Abstract Aflatoxin is the most powerful carcinogen and highly toxic mycotoxin known in nature. It can cause serious toxin pollution to agricultural products， foods and fodders， and is extremely harmful to human and animal health. For aflatoxin pollution， the emphasis is on the control of source， and biological control is favored by scientists because of its advantages of environmental protection and ecological safety. According to the morphology， color and appearance of microbial colonies isolated from maize kernels， 300 bacterial strains were obtained from main maizeproducing areas including Tangshan City， Handan City， Shijiazhuang City and Cangzhou City. Two biocontrol bacterial strains （B120 and B65） having a strong control effect on aflatoxins were screened. After identification by molecular biology and physical and chemical properties， the two biocontrol bacterial strains were identified as Bacillus amyloliquefaciens. Their effects on spore germination， mycelial growth and toxin degradation of Aspergillus flavus were investigated. The results showed that strains B120 and B65 could significantly inhibit the spore germination and mycelial growth of A. flavus and reduce aflatoxin production. This study provides a new way to prevent and control the pollution control of aflatoxins in agricultural products.
　　Key words Agricultural products; Food; Fodder; Aflatoxin contamination; Bioncontrol bacteria; Control effect
　　Maize is an important food crop and raw material of fodders in the world. It is highly susceptible to mold infection， especially aflatoxins when it encounters suitable growth conditions during harvesting， storage， transportation and processing. Aflatoxins are secondary metabolites mainly produced by Aspergillus flavus， A. parasiticus and other Aspergillus fungi. They have strong carcinogenicity and toxicity and are widely found in maize， peanut， rape and rice and other agricultural products[1-3]. How to scientifically and efficiently control aflatoxin pollution in agricultural products has become a global problem that needs to be solved urgently. This will seriously threaten the quality and safety of agricultural products and foods， and affect the health of humans and animals[1-3]. According to the existing research results， aflatoxins can cause liver function decline in animals， reduce animal immunity， and affect milk production of cows， and animals contaminated with toxins are more susceptible to infection by other microorganisms. Usually， young animals are more sensitive to A. flavus and more susceptible to toxin contamination[4-6]. 　　Since the discovery of aflatoxins， scientists have developed many methods and measures for toxin management， including physical， chemical and detoxification methods. However， these methods have more or less limitations and deficiencies. Even after applying these measures， the quality of agricultural products is greatly damaged， and chemical methods may cause secondary pollution， thus greatly limiting the application of these methods. For aflatoxin pollution， the emphasis is on the control of source， and biological control methods are favored by scientists because of their advantages of environmental protection， ecological safety and simultaneous prevention and control[7-8]. In this study， with A. flavus and its toxins as research objects， a highefficiency screening system for aflatoxinresistant biocontrol bacteria was constructed to screen effective antagonistic strains， and antifungal activity， toxininhibiting effect and detoxification capacity of the screened strains were investigated. This study provides a scientific basis for the exploration of new ways for controlling contaminate aflatoxin in agricultural products.
　　Materials and Methods
　　Tested strains
　　The A. flavus strain used in the experiment was isolated from maize kernels by the research team. The antagonistic microorganisms were isolated from maize kernels for feed produced in main maize producing areas such as Qianan City， Qianxi County， Zunhua City， Yutian County and Fengnan District of Hebei Province.
　　Acquisition of endogenous microorganisms
　　The maize kernels collected from various districts and counties were taken back to the laboratory for microbial separation. The seeds were immersed in 3% sodium hypochlorite solution for 3-5 min and then rinsed with sterile water for 3-5 times， and the water was drained. The maize kernels were ground in a mortar and placed on an LB plate， and cultured at a constant temperature of 28. The single colonies grown well were separated in time， and then purified and preserved on the LB slant[9-10].
　　Invitro screening of antagonistic microorganisms
　　The antagonistic microorganisms against A. flavus were screened by invitro culture method， and the specific method was referred to reference[10].
　　Invivo screening of antagonistic microorganisms
　　The preparation of the culture liquid， fermented liquid， supernatant and filtrate and the invivo screening of the antagonistic microorganisms were referred to the research method of Yao et al.[10]. 　　Inhibition of antagonistic microorganisms against A. flavus
　　Preparation of supernatant and filtrate
　　The activated biocontrol bacteria were cultured in LB culture medium at 37， and shaken at 160 r/min for 48 h. The prepared culture liquid was centrifuged at 12 000 r/min for 15 min， and the supernatant was separated. The supernatant was filtered through a 0.22 m germ filter， giving a filtrate.
　　Preparation of bacterial suspension
　　The culture liquid was centrifuged， obtaining the precipitate， which was added with sterile water， giving a bacterial suspension.
　　Crude protein extract
　　In order to achieve 70% saturation， solid ammonium sulfate was added to the supernatant， and after centrifugation at 10 000 r/min and 4 for 20 min， phosphate buffer （pH 7.0） was added to resuspend the precipitate. The suspension was then filtered with 0.22 m germ filter.
　　Effect of metabolites of the biocontrol bacteria on spore germination of A. flavus
　　106/ml spores of A. flavus and antagonistic bacteria were mixed and cultured in PD medium. The germination of A. flavus spores was observed at 8， 16 and 24 h of culture at 28， and the spore germination rate was calculated.
　　Effect of the antagonistic bacteria on mycelial growth and toxin production of A. flavus
　　A. flavus was cultured in the prepared supernatant， filtrate and crude protein extract to determine the effects on A. flavus growth and its toxin[9].
　　The reduction of aflatoxin by the antagonistic bacteria
　　The mixed standard of four kinds of aflatoxins were added to the broth medium fermented by the antagonistic bacteria for 24 h， and the toxin content was detected after culture at 37 for 2， 4 and 6 d. The experiment was repeated 3 times.
　　Simulated gastric fluid tolerance test
　　The simulated gastric fluid was prepared according to the method of Huang et al.[11]. Then， 0.5 ml of the bacterial liquid was added to 4.5 ml of the simulated gastric fluid， followed by thoroughly mixing on a shaker. The bacterial liquid was placed in an incubator and fully cultured at 37， and the living bacteria number in the culture liquid was counted at 0， 2 and 4 h after culture.
　　Identification of antagonistic strains
　　Identification method
　　The identification was performed according to conventional method in reference[12].
　　PCR amplification and sequencing of 16S rDNA
　　The DNA of the antagonistic bacteria was extracted according to the method of the extraction kit. The 16S rDNA of the antagonistic bacteria was amplified using 27 F （5，AGAGTTTGATCCTGGCTCAG3） and 1492R （5，CTACGGCTACCTTGTTACGA3） as primers. The PCR amplification was started at 98 for 5 min， followed by 35 cycles of 95 for 35 s， 55 for 35 s and 72 for 1 min， and completed at 72 for 8 min. The PCR amplification system included dNTPs （10 mmo1） l l， template DNA about 10 pmol， primers 27f and R1492 （10 mol/L） 1l each， primer Taq enzyme （5 U/l） 0.25 l， 10≠PCR buffer 5 l， and redistilled water to 50 l. The sequencing results were analyzed by homology comparison in GenBank using BLAST software to identify the antagonistic bacteria. 　　Results and Analysis
　　Isolation of microorganisms
　　According to the morphology， color and appearance of microbial colonies isolated from maize kernels， 300 bacterial strains were obtained， of which 65 strains were obtained from Tangshan City， 36 were obtained from Handan City， 40 were obtained from Shijiazhuang City， 51 were obtained from Cangzhou， and 108 were obtained from Xingtai City.
　　Screening of antagonistic bacteria
　　Invitro antagonistic effect
　　The experimental results showed that the inhibition rate of strain B120 against A. flavus was 97.0%， followed by 95.5% of strain B162 and 92.5% of B65. The antifungal activity of the three biocontrol bacterial strains was significant， and the strains with stronger antagonistic effect were further studied （Table 1）.
　　Invivo antagonistic effect
　　The microorganisms with a strong antagonistic effect obtained by screening under invitro conditions were tested for inhibition of aflatoxin contamination in maize kernels. LC/MS/MS results showed that the antagonistic microorganisms had a strong antagonistic effect on aflatoxin contamination on maize kernels. Among them， the inhibitory effect of strain B120 on aflatoxin was 85.0%， followed by 71.5% of B65 and 65.0% of B121. The prevention and control effects of strains B120 and B65 with the strongest toxinreducing capacity were further studied （Table 2）.
　　Effect of metabolites of the biocontrol bacteria on A. flavus
　　The results showed that the culture liquid， supernatant， filtrate and crude protein extract of the biocontrol bacteria had significant inhibitory effects on A. flavus. The inhibitory effect of the culture liquid of strain B120 on the mycelial growth of A. flavus was up to 90.5%， and the supernatant， filtrate and crude protein extract were 75.0%， 72.0% and 71.0%， respectively. The inhibitory effect of the culture liquid of strain B65 on the mycelial growth of A. flavus was 81.0%， and the inhibitory effects of the supernatant and filtrate reached 70.5% and 60.0%. Compared with strain B120， the crude protein extract of strain B65 had a lower antifungal effect （Table 3）.
　　Inhibition of aflatoxin production by biocontrol bacteria
　　It was found that after the mixed culture of A. flavus with strains B120 and B65， the production of toxins was significantly reduced. After 72 h of culture， four aflatoxins （B1， B2， G1 and G2） were all not detected， but the toxin AFG1 also had some natural degradation （Table 4）. The research results explored an important way for the development and application of aflatoxin pollution degradation technology. 　　Degradation of toxins by biocontrol bacteria
　　The experiment indicated that strains B120 and B65 could degrade aflatoxin. The results of LC/MS/MS showed that the degradation rates of aflatoxins by the two biocontrol bacterial strains were above 90%. On the fourth day of culture， the four aflatoxins were all detected， suggesting that strains B120 and B65 were able to significantly degrade aflatoxins. In addition， the degradation rates of G1 and G2 by the biocontrol bacteria were significantly higher than that of aflatoxins B1 and B2 （Table 5）.
　　Simulated gastric fluid tolerance test
　　The test results showed that the living bacteria number of strain B120 was higher than that of B65 under the simulated gastric liquid condition. After treatment with the simulated gastric liquid for 2 and 4 h， the living bacteria number of strain B120 did not change significantly， indicating that strain B120 has very strong tolerance to gastric acid， but B65 suffered from greater impact （Table 6）.
　　Identification of antagonistic strains B45 and B6
　　Physiological and biochemical identification
　　According to the results of physical and chemical indicators of strains B120 and B65， combined with the literature[10]， the two biocontrol bacterial strains were initially identified as Bacillus amyloliquefaciens.
　　Sequence analysis of 16S rDNA
　　After PCR amplification of strains B120 and B65， a product of about 1.45 kb was obtained. After BLAST alignment and Clustal W multiple sequence comparison， the homology of the two strains with B. amyloliquefaciens strain JF496388 reached 98%. Combined with the above physiological and biochemical indicators， B120 and B65 were identified as B. amyloliquefaciens.
　　Conclusions and Discussion
　　Aflatoxins can seriously pollute agricultural products and foods， threaten human and animal health， and even cause death. At present， countries all over the world are actively taking measures to eliminate the problem of mycotoxin contamination in agricultural products， but it is difficult to remove them by general processing methods[15-18]， and there are secondary pollution hazards in chemical methods. Therefore， it is imperative to explore effective and sensitive measures to prevent mycotoxin contamination. For aflatoxin pollution in agricultural products， the emphasis is on the control of source， and the methods of biological control and toxin biodegradation are favored by scientists because of their advantages of environmental protection and ecological safety[12-15]. This study was aimed at the prevention and control of aflatoxin contamination in maize forage， and adopted biological control technology that is harmless to the human body and environmentally friendly， in order to explore an effective way for the control of aflatoxin pollution in China. In this study， two strains with strong antagonistic activity against aflatoxins were isolated from 300 microbial strains. The inhibition rates of toxins were both over 95% under invitro conditions; and the control effects under living body conditions could reach more than 60%， and that of strain B120 can reach more than 75%， which was remarkable， so B120 has great potential for development and application. The antifungal and detoxification experiment of metabolites indicated that the culture liquid， supernatant， filtrate and crude protein extract of the two biocontrol bacterial strains can significantly reduce the growth of A. flavus and the production of toxins. In addition， it was found that the obtained two antagonistic strains can significantly inhibit the mycelial growth of A. flavus and the germination of conidia， and inhibit and alleviate the occurrence of aflatoxin infection and toxin contamination. In previous studies， there have been reports of the use of microorganisms to degrade aflatoxins at home and abroad. Kong et al.[19]found that the inhibition rate of marine Bacillus megatherium to aflatoxins was up to 50.8%. Abbas et al.[20]demonstrated that montoxinproducing A. flavus can inhibit the production of aflatoxins by A. flavus， and the inhibitory rate can reach more than 65%. In this study， the biocontrol bacteria B120 and B65 obtained through screening have stronger antifungal and toxindegrading effects， and is was found that the substances that eliminate aflatoxins are mainly protein metabolites， which have broad application prospects. However， the elimination mechanism of the two biocontrol bacterial strains on aflatoxins and their influences on the microbial flora and the quality of agricultural products need further exploration and research. 　　References
　　[1]FAN SF， LI PW， WANG XP， et al. Comparison on determination of aflatoxins in peanut， corn and rice by liquid chromatography and liquid chromatographytandem mass spectrometry[J]. Food Science， 2011， 32 （12）： 254-258. （in Chinese）
　　[2]LIU X. Strengthen research work of exposure and control of mycotoxin[J]. Chinese Journal of Preventive Medicine， 2006， 40： 307-308.
　　[3]ALPERT ME， HUTC MSR， WBGAN GN. Association between aflatoxin content of food and hepatoma frequency in Uganda[J]. Cancer， 1971， （28）： 253-260.
　　[4]JACKOBSON WC， WISEMAN HG. The transmission of aftatoxin B1 into eggs[J]. Poultry Science， 1974， 53： 1743-1745.
　　[5]TRUCKESS MW， STOLOFF L， YONG K. Aflatoxins B1 and M1 in eggs and tissues of laying hens consuming aftatoxin contaminated feed[J]. Poultry Science， 1983， 62： 2176-2182.
　　[6]IBEH IN， URAIH N， OGONAR JI. Dietary exposure to aflatoxin in human male infertility in Benin City， Nigeria[J]. International iournal of fertility and menopause studies， 1994， 4： 208-214.
　　[7]DEY R， PAL KK， BHATT DM， et al. Growth promotion and yieid enhancement of peanut （Arachis hypogaea L.） by application of plant growthpromoting rhizobacteria[J]. Microbiological Research， 2004， 159（4）： 371-394.
　　[8]HE H， QIU EX， HU FP， et al. Advance in biological effects of endophytic bacteria[J]. Journal of Microbiology， 2004， 24（3）： 40-45. （in Chinese）
　　[9]YAO YP， ZHANG LT， ZHENG BQ， et al. Screening of peanut endophytic bacterial antagonists against Aspergillus flavus， and identification and antagonistic activities of strain B851[J]. Journal of Peanut Science， 2016， 45（3）： 20-26. （in Chinese）
　　[10]YAO YP， DING D， ZHANG LT， XIANG AL， et al. Screening of biocontrol bacteria against Aspergillus flavus and antifungal activity of strain B423[J]. Journal of the Chinese Cereals and Oils Association， 2018， 33（3）： 84-88.
　　[11]HUANG Y， ADAMS MC. In vitro assessment of the upper gastrointestinal tolerance of potential probiotic dairy propionibacteria[J]. International Journal of Food Microbiology， 2004， 91（3）： 253-260.
　　[12]DONG XZ， CAI MY. Manual of identification in common bacteria[M]. Beijing： Science Press， 2001. （in Chinese）
　　[13]KIRK GD， BAH E， MONTESANO R. Molecular epidemiology of human liver cancer： Insights into etiology， pathogenesis and prevention from The Gambia[J]. Carcinogenesis， 2006， 27： 2070-82.
　　[14]GROOPMAN JD， KENSLER TW， WILD CP. Protective interventions to prevent aflatoxininduced carcinogenesis in developing countries[J]. Annual Review of Public Health， 2008， 29： 187-203. 　　[15]WU F， KHLANGWISET P. Health economic impacts and costeffectiveness of aflatoxin reduction strategies in Africa： Case studies in biocontrol and postharvest interventions[J]. Food Additives and Contaminants， 2010， 27： 496-509.
　　[16]LIU Y， WU F. Global burden of aflatoxininduced hepatocellular carcinoma： A risk assessment[J]. Environmental Health Perspectives， 2010， 118： 18-24.
　　[17]VAN EGMOND， DRAGACCI S. Liquid chromatographic method for aflatoxin M1 in milk[J]. Methods in Molecular Biology， 2001， 157： 59-69.
　　[18]TEKINSEN K， EKEN HS. Aflatoxin M1 levels in UHT milk and kashar cheese consumed in Turkey[J]. Food and Chemical Toxicology， 2008， 46： 3287-3289.
　　[19]KONG Q， LIU QZ， YU FT， et al. Inhibitory effect on the growth and aflatoxin biosynthesis of Aspergillus flavus by a strain of marine Bacillus[J]. Journal of Zhejiang University （Agriculture & Life Sciences）， 2010， 36（4）： 387-392. （in Chinese）
　　[20]ABBAS HK， ZABLOTOWICZ RM， BRUNS HA. Biocontrol of aflatoxin in corn by inoculation with nonaflatoxigenic Aspergillus flavus isolate[J]. Biocontrol Science and Technology， 2006， 16（5）： 437-449.