论文部分内容阅读
Abstract ［Objectives］ This study was conducted to establish the genetic marker BiPASA of STCH gene in Jinfen white pig and New Shanxi black pig.
［Methods］ The polymorphism of STCH gene was detected in Jinfen white pig and New Shanxi black pig by bidirectional PCR amplification of specific alleles.
［Results］ There were two alleles (A, B) and three genotypes (AA, AB and BB) in Jinfen white pig and New Shanxi black pig. The PopGene32 analysis showed that the polymorphic site of STCH gene in Jinfen white pig accorded with the HardyWeinberg equilibrium (P>0.05), while that of new Shanxi black pig did not meet the HardyWeinberg equilibrium (P<0.01). The results of chisquare test showed that the polymorphic site of STCH gene was significantly different in genotype distribution between the two pig breeds (P<0.01).
［Conclusions］ The establishment of the genetic marker BiPASA of STCH gene in Jinfen white pig and new Shanxi black pig could provide basic biological data for improving disease resistance of pigs and establishing diseaseresistant populations.
Key words STCH; Jinfen white pig; New Shanxi black pig; BiPASA; Polymorphism
Received: May 7, 2019Accepted: August 11, 2019
Supported by Doctoral Scientific Research Staring Foundation (YQ20190010); Scientific and Technological Innovation Programs of Higher Education Institutions in Shanxi (2019L0878).
Nunu SUN (1980-), female, P. R. China, lecturer, PhD, devoted to research about genetic breeding of pig.
*Corresponding author. Email: sunnunu@126.com.
STCH (Microsomal stress 70 protein ATPase core) gene is a member of the stress 70 protein gene chaperone family, which plays a central role in the processing of cytosolic and secreted proteins and enhances immunity and disease resistance in organisms by mediating related signaling pathways［1-2］. Members of this family have a highly conserved ATPase domain at the amino terminal and a peptidebinding domain at the carboxyl terminal, and under stress conditions, misfolded or denatured proteins can combine with ATPdependent mechanisms to process them［3］. Human STCH gene comprises 471 amino acid residues and the molecular weight of the protein is 60 KD. Porcine STCH gene is mapped to the q4649 locus of porcine chromosome 13 by linkage gene mapping and physical methods, and the porcine 13q4649 region shares high homology with human 21q11.1 region［4-5］. Bae et al.［6］ found that STCH plays a new role in regulating pH through sitespecific interaction with NBCe1B and NHE1 and subsequent regulation of membrane transporter expression, so it is believed that STCH may play a role of regulating pH during cell stress by promoting the recovery of intracellular acidification. Peptide stimulation and heat shock have no effect on STCH gene. Calcium stress can induce this gene, which plays an important role in the imbalance of calcium homeostasis in the pathogenesis of senile neurodegenerative diseases. It is considered to be a candidate gene for AD［7］. STCH gene can inhibit intracellular calcium overload and maintain calcium homeostasis. Other studies have found that the STCH level in the primary leukemia group was significantly lower than in the normal group［8-9］. Zhang et al.［10-11］ studied the effect of rat STCH on dopaminergic neurons and found that rat STCH gene had a higher expression level in liver and cerebellum, the lowest expression level in hippocampus, and was expressed in dopaminergic neurons in central gray matter area and not expressed in substantia nigra. Therefore, STCH gene plays an important role in disease resistance and immune regulation. In this study, the genetic marker BiPASA of STCH gene in Jinfen white pig and New Shanxi black pig was established, providing a basis for studying the important role of STCH gene in disease resistance and immune function of Jinfen white pig and new Shanxi black pig. Materials and Methods
Experimental materials
The ear tissue and tail tissue samples of 56 Jinfen white pigs and 35 new Shanxi black pigs were taken, disinfected with anhydrous ethanol, and then placed in autoclaved 1.5 ml centrifuge tubes, each of which contained 75% ethanol solution. The samples were then stored at -20 ℃. The experiment pigs were provided by Yuncheng Xinlongfeng Animal Husbandry Co., Ltd.
Protease K (GT0243), DL 2000 DNA Marker and 2×Taq PCR Mix were purchased from Beijing Huayueyang Biological Technology Co., Ltd.
Extraction of genomic DNA
The DNA in the ear or tail tissue was extracted with phenol∶chloroform∶isoamyl alcohol (25∶24∶1), dissolved in sterilized double distilled water, and stored at -20 ℃ until use.
Primer design and synthesis
Human and rat STCH gene sequences were downloaded from NCBI website. The porcine STCH gene primers were designed using Primer 5.0 software by Sangon Biotech (Shanghai) Co., Ltd. The primer information was as follows: upstream primer (STCHF1): 5′TGAGACAAGCTGTGGAAATGG3′, downstream primer (STCHR1): 5′ACTGCTAGGTCAGGGTCTACC3′, and BiPASAF1: 5′ggggcgggcgTGGAGCTACCCTTTCT3′, BiPASAR1: 5′ggggcgggcgCTCCATTTTTCTTTTCGG3′. The lowercase bases of the primers are noncomplementary and rich in G+C sequence. The amplification with STCHF1 and STCHR1 gave a fragment at 445 bp; that with STCHF1 and BiPASAR1 showed a 238 bp fragment; and that with BiPASAF1 and STCHR1 yielded a 215 bp fragment.
Bidirectional specific allele PCR amplification
The total PCR reaction system was 10 μl in a centrifuge tube, including DNA template 0.5 μl, sterilized deionized water 4 μl, primers STCHF, STCHR, BiPASAF and BiPASAR 0.2 μl each, and 2×Taq PCR Mix 5 μl. The PCR reaction started with predenaturation at 92 ℃ for 3 min, followed by 34 cycles of denaturation at 92 ℃ for 30 s, renaturation at 60 ℃ for 30 s and extension at 72 ℃ for 45 s, and completed with last extension at 72 ℃ for 5 min. The products obtained by amplification of BiPASA were immediately subjected to horizontal electrophoresis on 3% agarose gel for 50 min (100 V), and then the results were photographed and analyzed.
Statistical analysis
For the genotypic analysis results, Popgene 32 software was used for population genetic analysis to calculate relevant indexes, including allele frequency (Pi=2ii+ij1+ij2+…ija2N), polymorphism information content (PIC=1-∑ni=1p2i-∑n-1i=1∑nj=i+12p2ip2j), individual gene heterozygosity (k=1-∑ai=ap2i) and shannon index (SI=-clogPIC). The chisquare test was performed using SAS 8.1 statistical software to analyze the polymorphism of STCH gene in the two breeds, i.e., Jinfen white pig and new Shanxi black pig. Results and Analysis
Extraction of genomic DNA
As shown in Fig. 1, 1.2% agarose gel electrophoresis of DNA extracted by phenol∶chloroform∶isoamyl alcohol (25∶24∶1) showed that the DNA bands were clear, bright, and neat without tailing phenomenon, indicating that the extracted DNA was high in concentration, less contaminated by protein and RNA and can meet the requirements of following experimental parts.
Results of bidirectional PCR amplification of specific alleles
The genomic DNA of each of Jinfen white pig and New Shanxi black pig extracted from the above steps was used as a template, and two pairs of primers designed, STCHF1, STCHR1 and BiPASAF1, BiPASAR1, were used to perform bidirectional PCR amplification of specific alleles on the polymorphic site of the STCH gene in Jinfen white pig and new Shanxi black pig. The amplified products were detected by 3% agarose gel electrophoresis (100 V, 50 min). Three specific bands were observed, and no miscellaneous bands appeared, as shown in Fig. 2 and Fig. 3.
As can be seen from Fig. 2 and Fig. 3, two alleles (A, B) and such three genotypes as AA (445 bp/238 bp), AB (445 bp/238 bp/215 bp) and BB (238 bp/215 bp) were detected in both Jinfen white pig and new Shanxi black pig.
Allele and genotype frequency analysis of STCH gene in different pig breeds
The population genetic analysis of genotype distribution was performed using Popgene 32. As shown in Table 1, the frequencies of the three genotypes (AA, AB, and BB) detected in Jinfen white pig were 0.30, 0.48 and 0.21, respectively, and the frequencies of the two alleles (A, B) were 0.54 and 0.46, respectively. The frequencies of the three genotypes (AA, AB, and BB) detected in the New Shanxi black pig were 0.20, 0.77, and 0.03, respectively, and the frequencies of the two alleles (A, B) were 0.59 and 0.41, respectively. The statistical results showed that the dominant genotypes of Jinfen white pig and New Shanxi black pig were both AB type, and the dominant alleles of these two breeds were allele A.
Detection results of other indexes of Jinfen white pig and the new Shanxi black pig
The genetic characteristics of STCH gene in Jinfen white pig and New Shanxi black pig were analyzed by Popgene 32 software. According to Table 3, the shannon index (0.689 2) of Jinfen white pig was higher than that of New Shanxi black pig (0.678 4), indicating that the polymorphism of STCH gene was more abundant in Jinfen white pig. The homozygosity of Jinfen white pig (0.517 9) was higher than that of New Shanxi black pig (0.228 6), and the heterozygosity (0.482 1) was lower than that of new Shanxi black pig (0.771 4), indicating its genetic stability was higher. χ2 fitness test results showed that Jinfen white pig accorded with the HardyWeinberg equilibrium (P=0.781 978, P>0.05), while new Shanxi black pig did not meet the HardyWeinberg equilibrium (P=0.000 660, P<0.01). Genotype difference analysis
SAS 8.1 software was used to perform chisquare test. The differences in genotype distribution on the polymorphic site of STCH gene between Jinfen white pig and New Shanxi black pig reached a very significant level (chisquare value 19.492 9, P=0.000 01<0.01).
Discussion and Conclusions
Shi et al.［12］ detected a single base variation site at locus 1 050 of the fifth exon of the STCH gene coding region in European pigs including large white pig, PIC commercial pig, Yorkshire pig, Landrace and European wild boar, as well as Chinese pigs including Meishan Pig, Jinhua pig and Rongchang pig. It was found that allele B was not detected in European domestic pigs (Yorkshire pig, Landrace pig, European wild boar, and PIC commercial pig), and their genotype was only AA. Allele A was not detected in Chinese domestic pigs (Jinhua pig), and their genotype was only BB type, while the heterozygous AB type was only detected in large white pig, Rongchang pig and Meishan pig. Furthermore, only one heterozygote was detected in 12 Meishan pigs, and there was a significant difference between Rongchang pig and European large white pig, both of which were detected with higher genetic variation, indicating that the formation process of European large white pig may be infiltrated by Chinese pig genes. Comparing their results, we detected that there are three genotypes (AA, AB and BB) and two alleles (A, B) in Jinfen white pig and new Shanxi black pig breeds, indicating that these two pig breeds have higher genetic variation. It is speculated that this may be related to the fact that the parents are mixed with local pig breeds and foreign pig breeds, or may be caused by genetic and environmental factors. Shi et al.［12］ analyzed that the frequency of allele B of STCH gene in Chinese Rongchang pig was 0.77, the frequency of allele A was 0.23, and allele B was the dominant allele of this breed, while European large white pig was opposite to Rongchang pig, and its dominant allele was A. In this study, the dominant alleles of Jinfen white pig and new Shanxi black pig were both A, which is slightly different from the results of Shi Xianwei and others. This might be because that the artificial selection of these pig breeds is too large, resulting in a lower polymorphism than other slightly artificially selected pig breeds. It may also be caused by different pig breeds and small sample sizes. In this study, Jinfen white pig had higher homozygosity and was purer than new Shanxi black pig. Shi et al.［12］ found that STCH gene had a rich polymorphism in Rongchang pig among various pig breeds in China, while this study showed that the shannon index of Jinfen white pig was higher, and its polymorphism was richer, indicating that Jinfen white pig has greater potential for selection. In addition, χ2 fitness test results showed that Jinfen white pig accorded with the HardyWeinberg equilibrium (P=0.781 978, P>0.05), while new Shanxi black pig did not meet the HardyWeinberg equilibrium (P=0.000 660, P<0.01), which might be because that most of the selected samples were full siblings or half siblings, and the gene homology was higher, or the artificial selection and the selected sample size were smaller. It could be known from the chisquare test that the polymorphic site of the STCH gene was significantly different in genotype distribution between the two pig breeds (P=0.000 01<0.01), probably because of the large genetic variation in the evolution of the two pig breeds. In this study, STCH gene was firstly studied in Jinfen white pig and new Shanxi black pig at the DNA level for polymorphism, and the distribution of its genotypes in the two pig breeds was determined. The shannon index, homozygosity, heterozygosity and genotype distribution of STCH gene in Jinfen white pig and new Shanxi black pig breeds were determined, as well as the differences in genotype distribution of the gene in the two pig breeds. By such, the genetic marker for detecting STCH gene mutation in pigs were successfully established, thereby providing a theoretical basis for the breeding for disease resistance and molecular breeding of Jinfen white pig and new Shanxi black pig, and providing evidence for the biological function of STCH gene.
References
［1］ OTTERSON GA, FLYNN GC, KRATZKE RA, et al. Stch encodes the ATPase core of a microsomal stress 70 protein［J］. EMBO J, 1994, 1994, 13(5): 1216-1225.
［2］ BRODSKY G, OTTERSON GA, PARRY BB, et al. Localization of STCH to human chromosome 21q11［J］. Genomics, 1995: 627-628.
［3］ LYU LX, LI XL, GU HJ, et al. Screening and identification of the interaction of STCH and RanBP9 by yeast twohybrid system［J］. Chinese Journal of Neuroanatomy, 2008, 48-52. (in Chinese)
［4］ SHI XW, ZHANG YD, TUGGLE CK. Linkage mapping of porcine STCH further refines the HSA3/21 breakpoint on pig chromosome 13［J］. Animal Genetics, 2002: 395-397.
［5］ YAMAGATA N, FURUNO K, SONODA M, et al. Stomach cancerderived del223V226L mutation of the STCH gene causes loss of sensitization to TRAILmediated apoptosis［J］. Biochem Biophys Res Commun, 2008: 499-503.
［6］ BAE JS, KOO NY, NAMKOONG E, et al. Chaperone stress 70 protein (STCH) binds and regulates two acid/base transporters NBCe1B and NHE1［J］. J Biol Chem, 2013: 6295-305.
［7］ LYU LX, JIN RX, YAO JS, et al. Cloning and identification of differentially expressed genes in rat cortex and hippocampus induced by Aβ140［J］. Chinese Journal of Gerontology, 2003: 46-47. (in Chinese)
［8］ ZHENG L, YANG YF, DENG BY, et al. Preliminary study on STCH attenuates neurotoxic effect of Aβ2535 on SHSY5Y in vitro［J］. Chinese Journal of Neuroanatomy, 2010: 643-646. (in Chinese)
［9］ WU D, ZHAO XY, WANG SJ. Observation of plasma cholesterol level in patients with leukemia［J］. Zhejiang Practical Medicine, 1998, 28-29. (in Chinese)
［10］ OTTERSON GA, KAYE FJ. A core ATPase, Hsp 70 like structure is conserved in human, rat, and C. elegans STCH proteins［J］. Gene, 1997: 287-292.
［11］ ZHANG JP, LYU LX, LI XL, et al. Preliminary study on the protective role of STCH on dopaminergic neurons［J］. Chinese Journal of Neuroanatomy, 2008: 592-596. (in Chinese)
［12］ SHI XW, WEI L, HAN HJ. BiPASA Genetic Marker and Polymorphism of the Porcine STCH Gene［J］. Zoological Research, 2005(1): 76-81. (in Chinese)
［Methods］ The polymorphism of STCH gene was detected in Jinfen white pig and New Shanxi black pig by bidirectional PCR amplification of specific alleles.
［Results］ There were two alleles (A, B) and three genotypes (AA, AB and BB) in Jinfen white pig and New Shanxi black pig. The PopGene32 analysis showed that the polymorphic site of STCH gene in Jinfen white pig accorded with the HardyWeinberg equilibrium (P>0.05), while that of new Shanxi black pig did not meet the HardyWeinberg equilibrium (P<0.01). The results of chisquare test showed that the polymorphic site of STCH gene was significantly different in genotype distribution between the two pig breeds (P<0.01).
［Conclusions］ The establishment of the genetic marker BiPASA of STCH gene in Jinfen white pig and new Shanxi black pig could provide basic biological data for improving disease resistance of pigs and establishing diseaseresistant populations.
Key words STCH; Jinfen white pig; New Shanxi black pig; BiPASA; Polymorphism
Received: May 7, 2019Accepted: August 11, 2019
Supported by Doctoral Scientific Research Staring Foundation (YQ20190010); Scientific and Technological Innovation Programs of Higher Education Institutions in Shanxi (2019L0878).
Nunu SUN (1980-), female, P. R. China, lecturer, PhD, devoted to research about genetic breeding of pig.
*Corresponding author. Email: sunnunu@126.com.
STCH (Microsomal stress 70 protein ATPase core) gene is a member of the stress 70 protein gene chaperone family, which plays a central role in the processing of cytosolic and secreted proteins and enhances immunity and disease resistance in organisms by mediating related signaling pathways［1-2］. Members of this family have a highly conserved ATPase domain at the amino terminal and a peptidebinding domain at the carboxyl terminal, and under stress conditions, misfolded or denatured proteins can combine with ATPdependent mechanisms to process them［3］. Human STCH gene comprises 471 amino acid residues and the molecular weight of the protein is 60 KD. Porcine STCH gene is mapped to the q4649 locus of porcine chromosome 13 by linkage gene mapping and physical methods, and the porcine 13q4649 region shares high homology with human 21q11.1 region［4-5］. Bae et al.［6］ found that STCH plays a new role in regulating pH through sitespecific interaction with NBCe1B and NHE1 and subsequent regulation of membrane transporter expression, so it is believed that STCH may play a role of regulating pH during cell stress by promoting the recovery of intracellular acidification. Peptide stimulation and heat shock have no effect on STCH gene. Calcium stress can induce this gene, which plays an important role in the imbalance of calcium homeostasis in the pathogenesis of senile neurodegenerative diseases. It is considered to be a candidate gene for AD［7］. STCH gene can inhibit intracellular calcium overload and maintain calcium homeostasis. Other studies have found that the STCH level in the primary leukemia group was significantly lower than in the normal group［8-9］. Zhang et al.［10-11］ studied the effect of rat STCH on dopaminergic neurons and found that rat STCH gene had a higher expression level in liver and cerebellum, the lowest expression level in hippocampus, and was expressed in dopaminergic neurons in central gray matter area and not expressed in substantia nigra. Therefore, STCH gene plays an important role in disease resistance and immune regulation. In this study, the genetic marker BiPASA of STCH gene in Jinfen white pig and New Shanxi black pig was established, providing a basis for studying the important role of STCH gene in disease resistance and immune function of Jinfen white pig and new Shanxi black pig. Materials and Methods
Experimental materials
The ear tissue and tail tissue samples of 56 Jinfen white pigs and 35 new Shanxi black pigs were taken, disinfected with anhydrous ethanol, and then placed in autoclaved 1.5 ml centrifuge tubes, each of which contained 75% ethanol solution. The samples were then stored at -20 ℃. The experiment pigs were provided by Yuncheng Xinlongfeng Animal Husbandry Co., Ltd.
Protease K (GT0243), DL 2000 DNA Marker and 2×Taq PCR Mix were purchased from Beijing Huayueyang Biological Technology Co., Ltd.
Extraction of genomic DNA
The DNA in the ear or tail tissue was extracted with phenol∶chloroform∶isoamyl alcohol (25∶24∶1), dissolved in sterilized double distilled water, and stored at -20 ℃ until use.
Primer design and synthesis
Human and rat STCH gene sequences were downloaded from NCBI website. The porcine STCH gene primers were designed using Primer 5.0 software by Sangon Biotech (Shanghai) Co., Ltd. The primer information was as follows: upstream primer (STCHF1): 5′TGAGACAAGCTGTGGAAATGG3′, downstream primer (STCHR1): 5′ACTGCTAGGTCAGGGTCTACC3′, and BiPASAF1: 5′ggggcgggcgTGGAGCTACCCTTTCT3′, BiPASAR1: 5′ggggcgggcgCTCCATTTTTCTTTTCGG3′. The lowercase bases of the primers are noncomplementary and rich in G+C sequence. The amplification with STCHF1 and STCHR1 gave a fragment at 445 bp; that with STCHF1 and BiPASAR1 showed a 238 bp fragment; and that with BiPASAF1 and STCHR1 yielded a 215 bp fragment.
Bidirectional specific allele PCR amplification
The total PCR reaction system was 10 μl in a centrifuge tube, including DNA template 0.5 μl, sterilized deionized water 4 μl, primers STCHF, STCHR, BiPASAF and BiPASAR 0.2 μl each, and 2×Taq PCR Mix 5 μl. The PCR reaction started with predenaturation at 92 ℃ for 3 min, followed by 34 cycles of denaturation at 92 ℃ for 30 s, renaturation at 60 ℃ for 30 s and extension at 72 ℃ for 45 s, and completed with last extension at 72 ℃ for 5 min. The products obtained by amplification of BiPASA were immediately subjected to horizontal electrophoresis on 3% agarose gel for 50 min (100 V), and then the results were photographed and analyzed.
Statistical analysis
For the genotypic analysis results, Popgene 32 software was used for population genetic analysis to calculate relevant indexes, including allele frequency (Pi=2ii+ij1+ij2+…ija2N), polymorphism information content (PIC=1-∑ni=1p2i-∑n-1i=1∑nj=i+12p2ip2j), individual gene heterozygosity (k=1-∑ai=ap2i) and shannon index (SI=-clogPIC). The chisquare test was performed using SAS 8.1 statistical software to analyze the polymorphism of STCH gene in the two breeds, i.e., Jinfen white pig and new Shanxi black pig. Results and Analysis
Extraction of genomic DNA
As shown in Fig. 1, 1.2% agarose gel electrophoresis of DNA extracted by phenol∶chloroform∶isoamyl alcohol (25∶24∶1) showed that the DNA bands were clear, bright, and neat without tailing phenomenon, indicating that the extracted DNA was high in concentration, less contaminated by protein and RNA and can meet the requirements of following experimental parts.
Results of bidirectional PCR amplification of specific alleles
The genomic DNA of each of Jinfen white pig and New Shanxi black pig extracted from the above steps was used as a template, and two pairs of primers designed, STCHF1, STCHR1 and BiPASAF1, BiPASAR1, were used to perform bidirectional PCR amplification of specific alleles on the polymorphic site of the STCH gene in Jinfen white pig and new Shanxi black pig. The amplified products were detected by 3% agarose gel electrophoresis (100 V, 50 min). Three specific bands were observed, and no miscellaneous bands appeared, as shown in Fig. 2 and Fig. 3.
As can be seen from Fig. 2 and Fig. 3, two alleles (A, B) and such three genotypes as AA (445 bp/238 bp), AB (445 bp/238 bp/215 bp) and BB (238 bp/215 bp) were detected in both Jinfen white pig and new Shanxi black pig.
Allele and genotype frequency analysis of STCH gene in different pig breeds
The population genetic analysis of genotype distribution was performed using Popgene 32. As shown in Table 1, the frequencies of the three genotypes (AA, AB, and BB) detected in Jinfen white pig were 0.30, 0.48 and 0.21, respectively, and the frequencies of the two alleles (A, B) were 0.54 and 0.46, respectively. The frequencies of the three genotypes (AA, AB, and BB) detected in the New Shanxi black pig were 0.20, 0.77, and 0.03, respectively, and the frequencies of the two alleles (A, B) were 0.59 and 0.41, respectively. The statistical results showed that the dominant genotypes of Jinfen white pig and New Shanxi black pig were both AB type, and the dominant alleles of these two breeds were allele A.
Detection results of other indexes of Jinfen white pig and the new Shanxi black pig
The genetic characteristics of STCH gene in Jinfen white pig and New Shanxi black pig were analyzed by Popgene 32 software. According to Table 3, the shannon index (0.689 2) of Jinfen white pig was higher than that of New Shanxi black pig (0.678 4), indicating that the polymorphism of STCH gene was more abundant in Jinfen white pig. The homozygosity of Jinfen white pig (0.517 9) was higher than that of New Shanxi black pig (0.228 6), and the heterozygosity (0.482 1) was lower than that of new Shanxi black pig (0.771 4), indicating its genetic stability was higher. χ2 fitness test results showed that Jinfen white pig accorded with the HardyWeinberg equilibrium (P=0.781 978, P>0.05), while new Shanxi black pig did not meet the HardyWeinberg equilibrium (P=0.000 660, P<0.01). Genotype difference analysis
SAS 8.1 software was used to perform chisquare test. The differences in genotype distribution on the polymorphic site of STCH gene between Jinfen white pig and New Shanxi black pig reached a very significant level (chisquare value 19.492 9, P=0.000 01<0.01).
Discussion and Conclusions
Shi et al.［12］ detected a single base variation site at locus 1 050 of the fifth exon of the STCH gene coding region in European pigs including large white pig, PIC commercial pig, Yorkshire pig, Landrace and European wild boar, as well as Chinese pigs including Meishan Pig, Jinhua pig and Rongchang pig. It was found that allele B was not detected in European domestic pigs (Yorkshire pig, Landrace pig, European wild boar, and PIC commercial pig), and their genotype was only AA. Allele A was not detected in Chinese domestic pigs (Jinhua pig), and their genotype was only BB type, while the heterozygous AB type was only detected in large white pig, Rongchang pig and Meishan pig. Furthermore, only one heterozygote was detected in 12 Meishan pigs, and there was a significant difference between Rongchang pig and European large white pig, both of which were detected with higher genetic variation, indicating that the formation process of European large white pig may be infiltrated by Chinese pig genes. Comparing their results, we detected that there are three genotypes (AA, AB and BB) and two alleles (A, B) in Jinfen white pig and new Shanxi black pig breeds, indicating that these two pig breeds have higher genetic variation. It is speculated that this may be related to the fact that the parents are mixed with local pig breeds and foreign pig breeds, or may be caused by genetic and environmental factors. Shi et al.［12］ analyzed that the frequency of allele B of STCH gene in Chinese Rongchang pig was 0.77, the frequency of allele A was 0.23, and allele B was the dominant allele of this breed, while European large white pig was opposite to Rongchang pig, and its dominant allele was A. In this study, the dominant alleles of Jinfen white pig and new Shanxi black pig were both A, which is slightly different from the results of Shi Xianwei and others. This might be because that the artificial selection of these pig breeds is too large, resulting in a lower polymorphism than other slightly artificially selected pig breeds. It may also be caused by different pig breeds and small sample sizes. In this study, Jinfen white pig had higher homozygosity and was purer than new Shanxi black pig. Shi et al.［12］ found that STCH gene had a rich polymorphism in Rongchang pig among various pig breeds in China, while this study showed that the shannon index of Jinfen white pig was higher, and its polymorphism was richer, indicating that Jinfen white pig has greater potential for selection. In addition, χ2 fitness test results showed that Jinfen white pig accorded with the HardyWeinberg equilibrium (P=0.781 978, P>0.05), while new Shanxi black pig did not meet the HardyWeinberg equilibrium (P=0.000 660, P<0.01), which might be because that most of the selected samples were full siblings or half siblings, and the gene homology was higher, or the artificial selection and the selected sample size were smaller. It could be known from the chisquare test that the polymorphic site of the STCH gene was significantly different in genotype distribution between the two pig breeds (P=0.000 01<0.01), probably because of the large genetic variation in the evolution of the two pig breeds. In this study, STCH gene was firstly studied in Jinfen white pig and new Shanxi black pig at the DNA level for polymorphism, and the distribution of its genotypes in the two pig breeds was determined. The shannon index, homozygosity, heterozygosity and genotype distribution of STCH gene in Jinfen white pig and new Shanxi black pig breeds were determined, as well as the differences in genotype distribution of the gene in the two pig breeds. By such, the genetic marker for detecting STCH gene mutation in pigs were successfully established, thereby providing a theoretical basis for the breeding for disease resistance and molecular breeding of Jinfen white pig and new Shanxi black pig, and providing evidence for the biological function of STCH gene.
References
［1］ OTTERSON GA, FLYNN GC, KRATZKE RA, et al. Stch encodes the ATPase core of a microsomal stress 70 protein［J］. EMBO J, 1994, 1994, 13(5): 1216-1225.
［2］ BRODSKY G, OTTERSON GA, PARRY BB, et al. Localization of STCH to human chromosome 21q11［J］. Genomics, 1995: 627-628.
［3］ LYU LX, LI XL, GU HJ, et al. Screening and identification of the interaction of STCH and RanBP9 by yeast twohybrid system［J］. Chinese Journal of Neuroanatomy, 2008, 48-52. (in Chinese)
［4］ SHI XW, ZHANG YD, TUGGLE CK. Linkage mapping of porcine STCH further refines the HSA3/21 breakpoint on pig chromosome 13［J］. Animal Genetics, 2002: 395-397.
［5］ YAMAGATA N, FURUNO K, SONODA M, et al. Stomach cancerderived del223V226L mutation of the STCH gene causes loss of sensitization to TRAILmediated apoptosis［J］. Biochem Biophys Res Commun, 2008: 499-503.
［6］ BAE JS, KOO NY, NAMKOONG E, et al. Chaperone stress 70 protein (STCH) binds and regulates two acid/base transporters NBCe1B and NHE1［J］. J Biol Chem, 2013: 6295-305.
［7］ LYU LX, JIN RX, YAO JS, et al. Cloning and identification of differentially expressed genes in rat cortex and hippocampus induced by Aβ140［J］. Chinese Journal of Gerontology, 2003: 46-47. (in Chinese)
［8］ ZHENG L, YANG YF, DENG BY, et al. Preliminary study on STCH attenuates neurotoxic effect of Aβ2535 on SHSY5Y in vitro［J］. Chinese Journal of Neuroanatomy, 2010: 643-646. (in Chinese)
［9］ WU D, ZHAO XY, WANG SJ. Observation of plasma cholesterol level in patients with leukemia［J］. Zhejiang Practical Medicine, 1998, 28-29. (in Chinese)
［10］ OTTERSON GA, KAYE FJ. A core ATPase, Hsp 70 like structure is conserved in human, rat, and C. elegans STCH proteins［J］. Gene, 1997: 287-292.
［11］ ZHANG JP, LYU LX, LI XL, et al. Preliminary study on the protective role of STCH on dopaminergic neurons［J］. Chinese Journal of Neuroanatomy, 2008: 592-596. (in Chinese)
［12］ SHI XW, WEI L, HAN HJ. BiPASA Genetic Marker and Polymorphism of the Porcine STCH Gene［J］. Zoological Research, 2005(1): 76-81. (in Chinese)