论文部分内容阅读
Abstract In this study， the liver， kidney and spleen tissues were collected from pigs with suspected PR in a pig farm in Jiangyan District， Taizhou City for virus isolation and identification. The isolated virus was inoculated onto PK15 monolayer cells. The virus culture was collected to extract genomic DNA for PCR assay and indirect immunoinfluscent assay. The results showed that the isolated virus was porcine pseudorabies virus， which was named TAIZ130417. The growth titer of the isolated virus reached 108.12 TCID50/ml on PK15 cells. Rabbits inoculated with the isolated virus soon exhibited pseudorabies symptoms such as itching and eventually died. The results provided reference for in??depth research and scientific prevention and control of pseudorabies.
Key words Porcine pseudorabies virus； Isolation； Identification
Pseudorabies （PR） is an acute infectious disease caused by pseudorabies virus （PRV） that may lead to fever， itching （except pigs） and encephalomyelitis in a variety of livestock and wildlife[1]， especially in pigs. PRV can cause sow reproductive disorders， resulting in miscarriage， stillbirths and mummified fetuses. The mortality of newborn piglets infected with PRV may reach up to 100%. In addition， PRV infections generally cause slow growth in fattening pigs and semen quality reduction or even loss of reproduction value in breeding boar[2]. PR was first discovered in the United States. In China， PRV was first detected in cats in the late 1940s. In the early 60s， PRV was also found in pigs. At present， PR is widespread in China， which seriously threatens the health of herds and causes serious economic losses in the pig breeding industry[3-4]. In this study， the liver， kidney and spleen tissues were collected from pigs with suspected PR in a pig farm in Taizhou City for PRV isolation and identification， aiming at providing reference for in??depth research and scientific prevention and control of PR.
Materials and Methods
Diseased tissues
The liver， kidney and spleen tissues were collected from pigs with suspected PR in a pig farm in Jiangyan District， Taizhou City on April 17， 2013. The collected tissues were crushed， added with sterile PBS solution containing bispecific antibody by a ratio of 1 g： 5 ml and mixed evenly. The mixture was frozen and thawed three times and centrifuged. The supernatant was collected， filtered through a 0.22 ??m filter， and stored at -20 ?? before use.
Reagents， cells， positive serum and rabbits Genomic DNA rapid extraction kit （animal）， Taq DNA polymerase， dNTP Mix， 25 mmol/L MgCl2 and 10 ?? PCR buffer were produced by Sangon Biotech （Shanghai） Co.， Ltd.； 100 bp DNA Ladder and 6 ?? DNA gel loading dye were purchased from Fermentas Inc. PK15 cells were preserved by Jiangsu Provincial Research Center for Veterinary Epidemiology. Porcine??derived PRV positive serum was purchased from VMRD Inc.； goat anti??pig IgG??FITC was purchased from Santa Cruz Biotechnology， Inc. Trypsin??EDTA solution was purchased from Beyotime Institute of Biotechnology （Shanghai）； newborn bovine serum and DMEM medium were purchased from Sangon Biotech （Shanghai） Co.， Ltd. Four healthy rabbits were purchased from the farm of Jiangsu Agri??animal Husbandry Vocational College.
Primer design and synthesis
According to the literature[5]， one pair of PRV primers was designed based on a PRV gH gene segment that was 355 bp in length. Upstream primer： 5????GCGTGTACTGCGACTGCGTGTT??3??； downstream primer： 5????CGACCTGGCGTTTATTAACCGAGA??3??. Primers were synthesized by Sangon Biotech （Shanghai） Co.， Ltd..
Extraction and PCR assay of viral DNA
Viral DNA was extracted from the diseased tissues by using genomic DNA rapid extraction kit according to the introductions. PCR amplification was performed using the extracted DNA as a template. The total PCR reaction volume was 50 ??l， containing 5 ??l of 10 ?? buffer， 3 ??l of 25 mmol /L MgCl2， 1 ??l of 10 mmol/L dNTPs， and 1 ??l of each of upstream and downstream primers （20 ??mol/L）； sterile ultrapure water was added to a final volume of 50 ??l. The PCR amplification was started with initial denaturation at 94 ?? for 5 min， followed by 35 cycles of denaturation at 94 ?? for 30 s， annealing at 54 ?? for 30 s， and extension at 72 ?? for 30 s； the amplification was completed by holding the reaction mixture at 72 ?? for 10 min. PCR products were detected by 15 g/L agarose gel electrophoresis. The electrophoretogram was observed under a UV lamp. The results were photographed and recorded.
Virus isolation
After PCR assay， PRV??positive diseased tissue suspension was inoculated onto PK15 monolayer cells and incubated at 37 ?? for 1 h. After removal of inoculums， the cells were added with DMEM medium containing 2% newborn calf serum， incubated at 37 ?? in a 50 ml/L CO2 incubator and observed everyday. The blind passage was performed until the cytopathicity was stable and reached 80%. The virus culture was collected for PCR assay of PRV. IFA identification of the virus
The isolated virus was inoculated onto PK15 monolayer cells and incubated at 37 ?? for 1 h. The virus culture was collected， washed twice with PBS， added with maintenance media， and incubated for 72 h in a 5% CO2 incubator， with non??inoculated PK15 cells as the negative control. The cells were washed three times with PBS， fixed with frozen methanol for 30 min at 4 ??， washed three times with PBS， added with porcine??derived PRV positive serum， incubated at 37 ?? for 1 h， washed three times with PBS， added with FITC??conjugated goat anti??pig antibody， incubated at 37 ?? for 1 h， washed three times with PBS， and observed under an inverted Olympus fluorescence microscope.
Virus titration
The virus culture was diluted to 10-1-10-10 and inoculated separately to PK15 monolayer cells in a 96??well culture plate. Each dilution of virus culture was inoculated to eight wells. The last two rows of wells were inoculated with viral diluent as the control. The culture plate was placed in a 5% CO2 incubator at 37 ??. The cytopathic changes were observed 96 hours later. TCID50 was calculated according to the Reed??Muench method.
PRV inoculation
Two rabbits were inoculated subcutaneously with PRV isolate， 2 ml/rabbit； another two rabbits were injected with maintenance media as the negative control， 2 ml/rabbit. Rabbits in the experimental group and control group were reared in isolation. The clinical manifestation of rabbits was observed and recorded daily.
Results and Analysis
PCR assay of the diseased tissues
Genomic DNA was extracted from the diseased tissues of pigs with suspected PR for PCR assay. The amplified target band was 355 bp in length， which was in accordance with the expected results （Fig. 1）.
Virus isolation
The PRV??positive tissues were crushed， filtered through a 0.22 ??m bacterial filter and inoculated to PK15 monolayer cells. Typical cytopathic changes were observed after 24 h， including cell aggregation， rounding， exfoliation and netting （Fig. 2）. Genomic DNA was extracted for PCR assay. As shown in Fig. 1， a specific target fragment was amplified.
IFA identification
PK15 cells were inoculated with the virus isolate for IFA identification using porcine??derived PRV positive serum and FITC??conjugated goat anti??pig antibody. As shown in Fig. 3， typical specific green fluorescence was observed. However， no specific fluorescence was observed in non??inoculated PK15 cells. The results indicated that the virus isolate was PRV， which was named TAIZ130417. Virus titration
The cytopathic effect （CPE） of different dilutions of the virus isolate in PK15 cells on the 96??well cell plate was recorded. Based on the Reed??Muench method， the titer of the isolated virus reached 108.12 TCID50/ml.
PRV inoculation
At about 48 h post??inoculation， two rabbits in the experimental group showed symptoms of itching and continued to bite the ventral injection site， causing hair removal and bleeding； at 62 h post??inoculation， these rabbits exhibited opisthotonos and died. Rabbits in the control group showed no abnormal performance within 7 days after injection of maintenance media. The necropsy results indicated meningeal congestion， pulmonary hemorrhage with hemorrhagic spots of different sizes， tracheal ring hyperemia and bleeding， liver congestion and swelling with necrosis focus （Fig. 4）.
Guangfu GUO et al. Isolation and Identification of a Porcine Pseudorabies Virus Strain in Taizhou CityConclusion and Discussion
PR is an important infectious disease that threatens the pig breeding industry[6]. China is a large pig breeding country. Therefore， the in??depth research of PRV is of great significance.
PCR technique is a method for diagnosing viruses at the molecular level that can detect trace??level viruses. PCR has various advantages such as rapid detection， high sensitivity and strong specificity， which can not only detect PRV in cell culture， but also directly analyze clinical samples[7]. In this study， diseased tissues were collected from pigs with suspected PR for PCR assay， andPRV??positive culture was inoculated to the cells， which improved the success rate of cell isolation.
PRV is a type of pantropic virus that can proliferate in many cells. Porcine PK??15， SK6， PS cells， hamster BHK??21 cells， monkey Vero cells， GMK cells， and rabbit EP cells can be used to proliferate PRV. Specifically， PRV is most sensitive to porcine kidney cells and rabbit kidney cells. In production practice， porcine PK??15 or SK??16 cells are often used for PRV culture. In this study， PK??15 cells were selected for virus isolation and culture because PRV has strong sensitivity to these cells. In addition， PK??15cells are easy to culture and proliferate rapidly.
Indirect immunoinfluscent assay （IFA） is a good method for rapid diagnosis of PR in China， which has strong specificity and high sensitivity and does not cross??react with parvovirus， adenovirus， hemagglutinating encephalitis virus and enterovirus[9]. The isolated virus was identified by IFA. The results showed that PK15 cells inoculated with the isolated virus exhibited typical specific green fluorescence， whereas no specific fluorescence was observed in non??inoculated PK15 cells. Animal inoculation test is a common method for PRV detection by subcutaneously inoculating the supernatant of diseased tissues or isolated virus into rabbits or mice， and the results can be analyzed based on the clinical symptoms of rabbits or mice. Rabbits inoculated with PRV??containing inoculum may continue to bite the inoculation site， followed by hind limb paralysis， lying in the ground and eventually convulsing to death. Mice inoculated with PRV??containing inoculum also show neurological symptoms and eventually die. In this study， healthy rabbits reared in school farm were inoculated with virus culture died within 3 days. Typical neurological symptoms were observed， and anatomic pathological changes were evident according to necropsy results.
In this study， PRV??positive culture was inoculated to PK15 cells after PCR assay. According to the results of IFA identification， virus titration and rabbit inoculation test， a PRV strain was successfully isolated. The acquisition of this strain provides scientific reference for in??depth research of molecular biological characteristics of PRV and the development of effective immunologic agents.
References
[1] STRAW BE. Diseases of Swine[M]. 8th Edition. Beijing： China Agricultural University Press， 2000， 239-253.（in Chinese）
[2] CHU XH. Research and application of epidemiological investigation and prevention measures of porcine pseudorabies in Jilin Province[D]. Changchun： Jilin University， 2011.（in Chinese）
[3] TAMBA M， CALABRESE R， FINELLI E， et al. Risk factors for Aujeszky??s disease seropositivity of swine herds of a region of northern Italy[J]. Preventive Veterinary Medicine， 2002， 54（3）：203-212.
[4] TONG W， ZHANG QZ， ZHENG H， et al. Identification and characterization of a pseudorabies virus isolated from a dead piglet born to vaccinated sow[J]. Chinese Journal of Veterinary Parasitology， 2013， 21（3）：1-7.（in Chinese）
[5] HU H， JIA YY， YANG CH， et al. Multiplex PCR for detection of porcine pseudorabies virus， porcine parvovirus and porcine circovirus type 2[J]. Journal of Henan Agricultural University， 2010， 44（4）：421-424.（in Chinese）
[6] PENG JM， AN TQ， ZHAO HY， et al. Identification and antigenic variation of new epidemiology of pseudorabies virus from swine[J]. Chinese Journal of Preventive Veterinary Medicine， 2013， 35 （1）：1-4.（in Chinese）
[7] ECHEVERR?PA MG， PECORARO MR， PEREYRA NB， et al. Rapid diagnosis of pseudorabies virus infection in swine tissues using the polymerase chain reaction （PCR）[J]. Revista Argentina de Microbiolog¨?a， 2000， 32（3）：109-115.
[8] WU YF， ZHU L， XU ZW， et al. Identification of pseudorabies virus from pigs in Sichuan Province and its proliferation characterization[J]. Chinese Veterinary Science， 2013， 43（6）：557-564.（in Chinese）
[9] NI J， ZHOU XB， ZHANG XY， et al. Recent epidemiological surveillance of the antibody to field pseudorabies virus by differential ELISA in large??scaled swine farms[J]. China Animal Husbandry & Veterinary Medicine， 2007， 34 （9）：102-104.（in Chinese）
Key words Porcine pseudorabies virus； Isolation； Identification
Pseudorabies （PR） is an acute infectious disease caused by pseudorabies virus （PRV） that may lead to fever， itching （except pigs） and encephalomyelitis in a variety of livestock and wildlife[1]， especially in pigs. PRV can cause sow reproductive disorders， resulting in miscarriage， stillbirths and mummified fetuses. The mortality of newborn piglets infected with PRV may reach up to 100%. In addition， PRV infections generally cause slow growth in fattening pigs and semen quality reduction or even loss of reproduction value in breeding boar[2]. PR was first discovered in the United States. In China， PRV was first detected in cats in the late 1940s. In the early 60s， PRV was also found in pigs. At present， PR is widespread in China， which seriously threatens the health of herds and causes serious economic losses in the pig breeding industry[3-4]. In this study， the liver， kidney and spleen tissues were collected from pigs with suspected PR in a pig farm in Taizhou City for PRV isolation and identification， aiming at providing reference for in??depth research and scientific prevention and control of PR.
Materials and Methods
Diseased tissues
The liver， kidney and spleen tissues were collected from pigs with suspected PR in a pig farm in Jiangyan District， Taizhou City on April 17， 2013. The collected tissues were crushed， added with sterile PBS solution containing bispecific antibody by a ratio of 1 g： 5 ml and mixed evenly. The mixture was frozen and thawed three times and centrifuged. The supernatant was collected， filtered through a 0.22 ??m filter， and stored at -20 ?? before use.
Reagents， cells， positive serum and rabbits Genomic DNA rapid extraction kit （animal）， Taq DNA polymerase， dNTP Mix， 25 mmol/L MgCl2 and 10 ?? PCR buffer were produced by Sangon Biotech （Shanghai） Co.， Ltd.； 100 bp DNA Ladder and 6 ?? DNA gel loading dye were purchased from Fermentas Inc. PK15 cells were preserved by Jiangsu Provincial Research Center for Veterinary Epidemiology. Porcine??derived PRV positive serum was purchased from VMRD Inc.； goat anti??pig IgG??FITC was purchased from Santa Cruz Biotechnology， Inc. Trypsin??EDTA solution was purchased from Beyotime Institute of Biotechnology （Shanghai）； newborn bovine serum and DMEM medium were purchased from Sangon Biotech （Shanghai） Co.， Ltd. Four healthy rabbits were purchased from the farm of Jiangsu Agri??animal Husbandry Vocational College.
Primer design and synthesis
According to the literature[5]， one pair of PRV primers was designed based on a PRV gH gene segment that was 355 bp in length. Upstream primer： 5????GCGTGTACTGCGACTGCGTGTT??3??； downstream primer： 5????CGACCTGGCGTTTATTAACCGAGA??3??. Primers were synthesized by Sangon Biotech （Shanghai） Co.， Ltd..
Extraction and PCR assay of viral DNA
Viral DNA was extracted from the diseased tissues by using genomic DNA rapid extraction kit according to the introductions. PCR amplification was performed using the extracted DNA as a template. The total PCR reaction volume was 50 ??l， containing 5 ??l of 10 ?? buffer， 3 ??l of 25 mmol /L MgCl2， 1 ??l of 10 mmol/L dNTPs， and 1 ??l of each of upstream and downstream primers （20 ??mol/L）； sterile ultrapure water was added to a final volume of 50 ??l. The PCR amplification was started with initial denaturation at 94 ?? for 5 min， followed by 35 cycles of denaturation at 94 ?? for 30 s， annealing at 54 ?? for 30 s， and extension at 72 ?? for 30 s； the amplification was completed by holding the reaction mixture at 72 ?? for 10 min. PCR products were detected by 15 g/L agarose gel electrophoresis. The electrophoretogram was observed under a UV lamp. The results were photographed and recorded.
Virus isolation
After PCR assay， PRV??positive diseased tissue suspension was inoculated onto PK15 monolayer cells and incubated at 37 ?? for 1 h. After removal of inoculums， the cells were added with DMEM medium containing 2% newborn calf serum， incubated at 37 ?? in a 50 ml/L CO2 incubator and observed everyday. The blind passage was performed until the cytopathicity was stable and reached 80%. The virus culture was collected for PCR assay of PRV. IFA identification of the virus
The isolated virus was inoculated onto PK15 monolayer cells and incubated at 37 ?? for 1 h. The virus culture was collected， washed twice with PBS， added with maintenance media， and incubated for 72 h in a 5% CO2 incubator， with non??inoculated PK15 cells as the negative control. The cells were washed three times with PBS， fixed with frozen methanol for 30 min at 4 ??， washed three times with PBS， added with porcine??derived PRV positive serum， incubated at 37 ?? for 1 h， washed three times with PBS， added with FITC??conjugated goat anti??pig antibody， incubated at 37 ?? for 1 h， washed three times with PBS， and observed under an inverted Olympus fluorescence microscope.
Virus titration
The virus culture was diluted to 10-1-10-10 and inoculated separately to PK15 monolayer cells in a 96??well culture plate. Each dilution of virus culture was inoculated to eight wells. The last two rows of wells were inoculated with viral diluent as the control. The culture plate was placed in a 5% CO2 incubator at 37 ??. The cytopathic changes were observed 96 hours later. TCID50 was calculated according to the Reed??Muench method.
PRV inoculation
Two rabbits were inoculated subcutaneously with PRV isolate， 2 ml/rabbit； another two rabbits were injected with maintenance media as the negative control， 2 ml/rabbit. Rabbits in the experimental group and control group were reared in isolation. The clinical manifestation of rabbits was observed and recorded daily.
Results and Analysis
PCR assay of the diseased tissues
Genomic DNA was extracted from the diseased tissues of pigs with suspected PR for PCR assay. The amplified target band was 355 bp in length， which was in accordance with the expected results （Fig. 1）.
Virus isolation
The PRV??positive tissues were crushed， filtered through a 0.22 ??m bacterial filter and inoculated to PK15 monolayer cells. Typical cytopathic changes were observed after 24 h， including cell aggregation， rounding， exfoliation and netting （Fig. 2）. Genomic DNA was extracted for PCR assay. As shown in Fig. 1， a specific target fragment was amplified.
IFA identification
PK15 cells were inoculated with the virus isolate for IFA identification using porcine??derived PRV positive serum and FITC??conjugated goat anti??pig antibody. As shown in Fig. 3， typical specific green fluorescence was observed. However， no specific fluorescence was observed in non??inoculated PK15 cells. The results indicated that the virus isolate was PRV， which was named TAIZ130417. Virus titration
The cytopathic effect （CPE） of different dilutions of the virus isolate in PK15 cells on the 96??well cell plate was recorded. Based on the Reed??Muench method， the titer of the isolated virus reached 108.12 TCID50/ml.
PRV inoculation
At about 48 h post??inoculation， two rabbits in the experimental group showed symptoms of itching and continued to bite the ventral injection site， causing hair removal and bleeding； at 62 h post??inoculation， these rabbits exhibited opisthotonos and died. Rabbits in the control group showed no abnormal performance within 7 days after injection of maintenance media. The necropsy results indicated meningeal congestion， pulmonary hemorrhage with hemorrhagic spots of different sizes， tracheal ring hyperemia and bleeding， liver congestion and swelling with necrosis focus （Fig. 4）.
Guangfu GUO et al. Isolation and Identification of a Porcine Pseudorabies Virus Strain in Taizhou CityConclusion and Discussion
PR is an important infectious disease that threatens the pig breeding industry[6]. China is a large pig breeding country. Therefore， the in??depth research of PRV is of great significance.
PCR technique is a method for diagnosing viruses at the molecular level that can detect trace??level viruses. PCR has various advantages such as rapid detection， high sensitivity and strong specificity， which can not only detect PRV in cell culture， but also directly analyze clinical samples[7]. In this study， diseased tissues were collected from pigs with suspected PR for PCR assay， andPRV??positive culture was inoculated to the cells， which improved the success rate of cell isolation.
PRV is a type of pantropic virus that can proliferate in many cells. Porcine PK??15， SK6， PS cells， hamster BHK??21 cells， monkey Vero cells， GMK cells， and rabbit EP cells can be used to proliferate PRV. Specifically， PRV is most sensitive to porcine kidney cells and rabbit kidney cells. In production practice， porcine PK??15 or SK??16 cells are often used for PRV culture. In this study， PK??15 cells were selected for virus isolation and culture because PRV has strong sensitivity to these cells. In addition， PK??15cells are easy to culture and proliferate rapidly.
Indirect immunoinfluscent assay （IFA） is a good method for rapid diagnosis of PR in China， which has strong specificity and high sensitivity and does not cross??react with parvovirus， adenovirus， hemagglutinating encephalitis virus and enterovirus[9]. The isolated virus was identified by IFA. The results showed that PK15 cells inoculated with the isolated virus exhibited typical specific green fluorescence， whereas no specific fluorescence was observed in non??inoculated PK15 cells. Animal inoculation test is a common method for PRV detection by subcutaneously inoculating the supernatant of diseased tissues or isolated virus into rabbits or mice， and the results can be analyzed based on the clinical symptoms of rabbits or mice. Rabbits inoculated with PRV??containing inoculum may continue to bite the inoculation site， followed by hind limb paralysis， lying in the ground and eventually convulsing to death. Mice inoculated with PRV??containing inoculum also show neurological symptoms and eventually die. In this study， healthy rabbits reared in school farm were inoculated with virus culture died within 3 days. Typical neurological symptoms were observed， and anatomic pathological changes were evident according to necropsy results.
In this study， PRV??positive culture was inoculated to PK15 cells after PCR assay. According to the results of IFA identification， virus titration and rabbit inoculation test， a PRV strain was successfully isolated. The acquisition of this strain provides scientific reference for in??depth research of molecular biological characteristics of PRV and the development of effective immunologic agents.
References
[1] STRAW BE. Diseases of Swine[M]. 8th Edition. Beijing： China Agricultural University Press， 2000， 239-253.（in Chinese）
[2] CHU XH. Research and application of epidemiological investigation and prevention measures of porcine pseudorabies in Jilin Province[D]. Changchun： Jilin University， 2011.（in Chinese）
[3] TAMBA M， CALABRESE R， FINELLI E， et al. Risk factors for Aujeszky??s disease seropositivity of swine herds of a region of northern Italy[J]. Preventive Veterinary Medicine， 2002， 54（3）：203-212.
[4] TONG W， ZHANG QZ， ZHENG H， et al. Identification and characterization of a pseudorabies virus isolated from a dead piglet born to vaccinated sow[J]. Chinese Journal of Veterinary Parasitology， 2013， 21（3）：1-7.（in Chinese）
[5] HU H， JIA YY， YANG CH， et al. Multiplex PCR for detection of porcine pseudorabies virus， porcine parvovirus and porcine circovirus type 2[J]. Journal of Henan Agricultural University， 2010， 44（4）：421-424.（in Chinese）
[6] PENG JM， AN TQ， ZHAO HY， et al. Identification and antigenic variation of new epidemiology of pseudorabies virus from swine[J]. Chinese Journal of Preventive Veterinary Medicine， 2013， 35 （1）：1-4.（in Chinese）
[7] ECHEVERR?PA MG， PECORARO MR， PEREYRA NB， et al. Rapid diagnosis of pseudorabies virus infection in swine tissues using the polymerase chain reaction （PCR）[J]. Revista Argentina de Microbiolog¨?a， 2000， 32（3）：109-115.
[8] WU YF， ZHU L， XU ZW， et al. Identification of pseudorabies virus from pigs in Sichuan Province and its proliferation characterization[J]. Chinese Veterinary Science， 2013， 43（6）：557-564.（in Chinese）
[9] NI J， ZHOU XB， ZHANG XY， et al. Recent epidemiological surveillance of the antibody to field pseudorabies virus by differential ELISA in large??scaled swine farms[J]. China Animal Husbandry & Veterinary Medicine， 2007， 34 （9）：102-104.（in Chinese）