论文部分内容阅读
Abstract In this study， Va1686 gene was cloned from Vibrio alginolyticus. The total length of the gene is 1 164 bp， and it could encode 387 amino acids. The physicochemical properties， protein structure， genetic evolutionary relationship and antigenic characteristics of the effect protein Va1686 of V. alginolyticus HY9901 type III secretion system were studied and analyzed by bioinformatics methods and tools. The results showed that Va1686 is a stable hydrophilic and acidic protein without a transmembrane region and a signal peptide， and secondary structure to ????helix. The evolutionary analysis showed that V. alginolyticus HY9901 and V. harveyi were clustered together， which indicated that the genetic relationship between the two species was the closest. Va1686 contains a Fic superfamily conserved domain associated with cell division. Bioinformatics analysis showed that the B??cell preponderant epitopes of Va1686 might be localized in the regions of 48-49， 82-85， 125-126， 150-153， 185-186， 236-237 and so on. The 3D structure model of Va1686 subunit was simulated by SWISS??MODEL software and it was found that the vopS of V. parahaemolyticus was similar and the similarity was 89.46%. In this study， the feasibility of Va1686 as a common antigen of Vibrio was verified from the perspective of bioinformatics， which laid the foundation for the next step in vaccine development.
Key words Vibrio alginolyticus； Type III secretory system； Effect protein； Bioinformatics analysis
Vibrio alginolyticus is a type of Gram??negative bacteria， in the shape of a short rod. It is halophilic， and has no spores and capsule[1] ， belonging to Vibrio in Vibrionaceae family. V. alginolyticus is a kind of common marine conditioned pathogen， as well as one of the main pathogens causing vibriosis in aquatic animals. V. alginolyticus could cause infectious vibriosis of fish， shrimp and shellfish in a larger scale[2]， thereby resulting in serious economic loss for aquaculture industry. Moreover， this pathogen could cause various human diseases including otitis media， diarrhea and blood poisoning[3]， thereby seriously threatening human health.
Type III secretion system （T3SS） has been ascertained to be a virulent element in the shape of a needle conservatively existing in bacteria， which activates the secretory pathway depending on the contact with host cells and infuses type III secreted system effector proteins （T3SEs） to host cells， thereby affecting normal metabolism and function of host cells and causing cytoskeleton and immune dysfunction of host cells， which further induce the death of host cells[4-5]. T3SS has become one of the research hotspots on pathogens in recent years. The research team of this study has done in??depth studies on V. alginolyticus Type III secretion system molecular chaperone and injectisome protein[6a，6b]， laying a foundation for the study on other proteins of V. alginolyticus Type III secretion system. In the preliminary study， the research team obtained the Type III secretion system effector protein Va1686， and its full length （GenBank： KX245316.1） was obtained through further sequencing and sequence alignment. In this study， in order to further study its biological function， the protein sequence of Va1686 was systematically predicted and studied by bioinformatics methods and tools.
Materials and Methods
Materials
Complete amino acid sequence of HY9901 V. alginolyticus effector protein Va1686 （GenBank： KX245316.1）， committed by the laboratory， serving as the object of study； Escherichia coli DH5??， provided by the laboratory； cloning vector pMD18??T Vector， purchased from TaKaRa （Dalian）； Easy Taq and Ex Taq， purchased from Transgen Biotech； PCR amplifier， purchased from Bio??Rad company； UNIQ??10 column type bacterial genomic Ezup Column Bacteria Genomic DNA Purification Kit.
Extraction of total DNA of V. alginolyticus
Single colonies of V. alginolyticus were cultured with TSB medium， and subjected to DNA extraction according to the instruction of DNA purification kit.
Amplification of V. alginolyticus Va1686 gene fragment
The sequence fragment encoded by Va1686 gene was amplified using following primers： forward primer V1： 5????ATGATCAGTTTTGGAAGTGTT??3??， and reverse primer V2： 5????TCACTTAAT ACCGTGAAGGCTA??3??. The PCR program was started with 94 ??for 5 min， followed by 35 cycles of 94 ?? for 45 s， 55 ?? for 45 s and 72 ?? for 90 s， and 72 ?? for 10 min， and the product was preserved at 4 ??. Then， the PCR product was subjected to electrophoresis detection， recovery of target band， ligation with pMD 18??T Vector， and transformation of ligation product. The selected clones were subjected to PCR identification， and positive clones were selected for sequencing [Sangon Biotech （Guangzhou） Co.， Ltd.].
Methods
The physicochemical properties of V. alginolyticus Va1686 protein were analyzed using ExPASy software with reference to literature[7] . The N??terminal signial peptide sequence of Va1686 protein was predicted using SignalP 4.1 Server software. Transmembrane domains were predicted using TMHMM Server 2.0 software. Subcellular localization was performed using PSORT. The potential phosphorylation sites and glycosylation sites were predicted using SoftBerry??Psite software. The amino acid sequences of other Vibrio strains similar to the studied protein were searched in NCBI using the provided BLAST online searching software. These amino acid sequences were analyzed using MEGA6.0 software by neighbor??joining method （NJ）. Multiple sequence analysis of amino acids were performed using ClustalX2 software， so as to deduce the evolutionary relationship of this protein with different strains. The secondary structure of Va1686 was predicted by Chou??Fasman method， and the hydrophilic parameter of Va1686 was predicted by Kyte??Doolittle method； the flexibility parameter was predicted by Karplus??Schulz method； the surface probability parameter of Va1686 was predicted by Emini method； and the antigenicity parameter of Va1686 was predicted by Jameson??Wolf method. The results of the various parameters were compared， and finally， the B??cell preponderant epitopes of V. alginolyticus HY9901 Va1686 protein were determined using DNAstar software according to the various parameters comprehensively. Homologous modeling of V. alginolyticus Va1686 protein was performed using SWISS??MODEL software， to predict its 3??D structure. Results and Analysis
Cloning of Va1686 gene
Through PCR amplification， a specific band at about1 164 bp was obtained （Fig. 1）. The product was ligated with the cloning vector pMD18??T， and the ligation product was sequenced by sequencing company. The Va1686 gene contains a 1 164 bp open reading frame （ORF）， and could encode 387 amino acids. The gene was submitted to GenBank， with an accession number of KX245316.
M： DNA marker DL2000； 1-3： Va1686 PCR product.
Fig. 1 PCR amplification of Va1686 gene
Physicochemical properties and sequence analysis
The physicochemical properties of V. alginolyticus Va1686 protein （Table 1） were analyzed using ExPASy （http：//web.expasy.org/protparam/） software. The molecular structural formula of Va1686 is C1798H2874N520O580S13， with a total atom number of 5 785. Va1686 is a stable hydrophilic protein with a theoretical pI value of 5.71. The protein is acidic without cysteine， pyrrolysine and selenocysteine.
The Va1618 protein was subjected to signal peptide prediction using SignalP 4.1 Server （http：//www.cbs.dtu.dk/services/SignalP/） online software， and the results show that the protein contains no significant signal peptide cleavage sites. PORST（https：//psort.hgc.jp/） subcellular localization prediction showed that Va1686 exists in cytoplasm. The prediction using TMHMM Server 2.0 （http：//www.cbs.dtu.dk/services/TMHMM??2.0/） online software shows that Va1686 contains no transmembrane domain. The prediction using SoftBerry??Psite （http：//linux1.softberry.com/berry.phtml？ topic=psite&group=programs & subgroup=proloc） online software shows that the amino acid sequence of Va1686 potentially contains two casein kinase II phosphorylation sites， three protein kinase C phosphorylation sites， six N??glycosylation sites， nine N??myristoylation sites and 12 microbodies C??terminal targeting signal sites （Fig. 2）.
The Va1686 protein sequence of V. alginolyticus HY9901 was subjected to homology comparison with other Vibrio strains including V. harveyi and V. parahaemolyticus through Blast （http：//blast.ncbi.nlm.nih.Gov/Blast.cgi）. The results show that Va1686 protein is relatively stable in Vibrio（Fig. 3）. A phylogenetic tree was built with Va1686 protein sequence of V. alginolyticus HY9901 and similar protein sequences of other Vibrio strains using MEGA 6.0 system software， and the results showed that V. alginolyticus HY9901 and V. harveyi were clustered together， indicating that the genetic relationship between the two species was closest （Fig. 4）. Prediction of function domains and higher structure of Va1686
The amino acid sequence of Va1686 protein was committed to NCBI online conserved domain database CDD （http：//www.ncbi.nlm.nih.gov/Structure/Lexingt??on/lexington.cgi） to be analyzed， and the results show that Va1686 contains a Fic superfamily conserved domain （Fig. 5）. The secondary structure of Va1686 was predicted using SOPMA （https：//npsa??prabi.ibcp. fr/cgi??bin/npsa_automat.pl？page=/NPSA/npsa_sopma.html） online software， and the results show that in the secondary structure of Va1686，alpha helix accounts for 57.62%， random coil accounts for 25.58%， extended strand accounts for 8.53%， and beta sheet accounts for 8.27% （Fig. 6）.
According to Chou??Fasman method， the secondary structure of Va1686 was mainly ????helix and ????sheet， which were mainly distributed in the regions of 3-6， 23-26， 28-31， 48-51， 59-62， 68-71， 82-85， 104-107， 123-126， 128-131， 150-153 and 174-177， and 185-192， 216-223， 234-241， 254-257， 271-274， 279-282， 295-316， 329-332， 346-349， 352-359 and 369-376， as shown in 7A. Generally， there are abundant turn structures between ????helix and ????sheet. Because turn structure is loose， these regions would be bound with antibodies easily， thereby forming epitopes.
The hydrophilcity of Va1686 was analyzed by Kyte??Doolittle method. As shown in Fig. 7B， the hydrophilic regions of Va1686 were located in the ranges of 15-52， 58-71， 80-110， 121-154， 172-177 and 180-191， and 204-224， 227-244， 252-262， 365-303， 316-338， 350-359 and 366-387.
The flexibility of Va1686 was predicted according to Karplus??Schulz method. The flexible regions were located in the regions of 16-20， 22-33， 39-51， 59-72， 82-89， 105-114， 121-133， 148-156， 160-163 and 173-178， and 183-191， 205-209， 215-222， 233-243， 252-277， 282-284， 293-316， 326-338， 351-357， 368-373 and 380-382 （Fig. 7C）. The structure of a protein depends on its flexibility to a certain degree， and the larger the flexibility， the easier the regions with higher flexibility distort， which is beneficial to the chimerism with antibodies.
The antigenicity index was predicted by Jameson??Wolf method， and there were more regions： 16-35， 42-52， 58-72， 80-93， 105-112 and 121-133， and 145-154， 171-177， 183-191， 206-212， 215-221， 228-243， 252-262， 270-279， 281-287， 292-318， 326-337， 349-358， and 367-382， which have higher antigenicity index（Fig. 7D）.
The surface probability was predicted by Emini method. The results showed that there were 17 regions in total： 15-18， 32-35， 41-49， 66-68， 82-91， 125-133， 140-142， 148-154 and 182-186， and 205-210， 253-261， 269-274， 281-284， 293-301， 327-336， 369-371 and 378-380（Fig. 7E）. Using DNAStar software， the secondary structure， hydrophilcity， flexibility， antigenicity index and surface probability were comprehensively analyzed， and the characteristics of 12 regions satisfied requirements to all above indices： 48-49， 82-85， 125-126， 150-153， 185-186， 236-237， 254-257， 271-274， 295-301， 329-332， 353-354 and 369-371. These 12 regions had higher comprehensive indices， and could be deduced to contain potential B??cell preponderant epitopes.
Prediction of tertiary structure
Homologous modeling of V. alginolyticus HY9901 Va1686 protein was performed using SWISS??MODEL （http：//swissmodel. expasy.org/） online software， obtaining the 3??D structure model of Va1686 protein subunit （Fig. 8）. The results showed that the vopS of V. parahaemolyticus was similar[8]， and the similarity was 89.46%（Fig. 8）.
Discussion
Type III secreted system effector proteins are important executors of bacterial virulence， as well as the key of the interaction between pathogens and hosts. With the Va1686 protein sequence committed to NCBI by the research team of this study as the object of study， it was found by bioinformatics analysis that Va1686 protein belongs to soluble protein without a transmembrane domain and an obvious signal peptide， which satisfies the characteristic that this type of proteins enter hosts to play their role with the need for the help of molecular chaperones， which coincides with the prediction result of subcellular localization. The secondary structure of Va1686 protein satisfies the "??+??" folding pattern[9]. This amino acid sequence contains two casein kinase II phosphorylation sites， three protein kinase C phosphorylation sites， six N??glycosylation sites， nine N??myristoylation sites and 12 microbodies C??terminal targeting signal sites. Phosphorylation is a kind of biological modification after the protein translation[10-11]， which could improve the specificity of proteins. Because V. alginolyticus contains no Golgi apparatus and endoplasmic reticulum， it could not further process the proteins obtained after translation， and could not perform modification of amidation or glycosylation. However， phosphorylation is not influenced[12]， and in future studies， the construction of mutant strains with the deletion of phosphorylation sites to further perform in??depth function analysis.
Through the alignment of protein sequences of various Vibrio strains， it was found that the Va1686 protein in Vibrio was highly similar， indicating that the protein is relatively stable in the evolutionary process of Vibrio. On the built phylogenetic tree，V. alginolyticus HY9901 was clustered together with V. harveyi， indicating that the genetic relationship between the two species was closest， which also satisfies the results of morphological and biochemical classification. Comprehensively from the prediction of B??cell preponderant epitopes and the alignment of amino acid sequences， it was speculated that Va1686 protein might be the common antigen of Vibrio， and could serve as the candidate protein of Vibrio subunit vaccine. The analysis on the structure of Va1686 protein show that the protein contains a Fic superfamily conserved domain. Fic protein belongs to Fic/DOC family， and the domain is correlated with cell division. It has been demonstrated that Fic protein could control cell division by influencing the synthesis of PAB or folic acid[13]. The 3D structure model of Va1686 subunit was simulated by SWISS??MODEL software and it was found that the vopS of V. parahaemolyticus was similar and the similarity was 89.46%.VopS （vp1686） of V. alginolyticus could inhibit the signal path of NF????B[14]， and block the binding of Rho GTP enzyme in mammalian cells with downstream signal molecules through AMPylation of the enzyme， thereby influencing the assembly of cytoskeleton， and as a result， cells became round， and finally died[15]. Therefore， whether this protein could play a role the same as or similar to VopS in host cells will be the emphasis of future research.
In this study， the type III secreted system effector protein Va1686 of V. alginolyticus was subjected to bioinformatics analysis， and the secondary structure， 3D structure， conserved domains and B??cell preponderant epitopes of the protein were predicted and analyzed， with an attempt to lay a foundation for the profound understanding of the action mechanism between type III secreted system effector protein and host cells. This study laid a foundation for further research and development of vaccine.
References
[1] H?ZRMANSDORFER S， WENTGES H， NEUGEBAURB¨?CHLER K， et al. Isolation of Vibrio alginolyticus from seawater aquaria[J]. International Journal of Hygiene & Environmental Health， 2000， 203（2）， 169-175.
[2] SADOK K， MEJDI S， NOURHEN S， et al. Phenotypic characterization and rapd fingerprinting of Vibrio parahaemolyticus and Vibrio alginolyticus isolated during tunisian fish farm outbreaks[J]. Folia Microbiologica， 2013， 58（1）， 17-26.
[3] SGANGA G， COZZA V， SPANU T， et al. Global climate change and wound care： case study of an off??season Vibrio alginolyticus infection in a healthy man[J]. Ostomy/wound Management， 2009， 55（4）： 60-62.
[4] BURDETTE DL， SEEMANN J， ORTH K. Vibrio VopQ induces PI3??kinase??independent autophagy and antagonizes phagocytosis[J]. Molecular Microbiology， 2009， 73（4）：639-649.
[5] PANG HY， QIU M， ZHAO J， et al. Construction of a Vibrio alginolyticus hopPmaJ （hop） mutant and evaluation of its potential as a live attenuated vaccine in orange??spotted grouper （Epinephelus coioides）[J]. Fish Shellfish Immunol， 2018， 76（5）： 93-100. [6a] PANG HY， ZHOU ZJ， DING Y， et al. Molecular Cloning and Bioinformatics Analysis of T3SS Chaperone Escort Protein VscO from Vibrio alginolyticus[J]. Biotechnology Bulletin， 2014 （6）： 155-161.
[6b] PANG HY， ZHOU ZJ， DING Y， et al. Prokaryotic expression and immunogenicity of the type III secretion system injectisome protein VscO from Vibrio alginolyticus， Guangdong Haiyangdaxue Xuebao[J]. Journal of Guangdong Ocean University， 2014， 34（3）， 41-46.
[7] WILKINS MR， GASTEIGER E， BAIROCH A， et al. Protein identification and analysis tools in the expasy server[J]. Methods in Molecular Biology， 1999， 112（112）： 531-552.
[8] ONO T， PARK KS， UETA M， IIDA T， et al. Identification of proteins secreted via Vibrio parahaemolyticus type III secretion system 1[J]. Infection & Immunity， 2006， 74（2）： 1032-42
[9] MURZIN AG， BRENNER SE， HUBBARD T， et al. SCOP： A structural classification of proteins for the investigation of sequences and structures[J]. Journal of Molecular Biology， 1995（247）： 536-540.
[10] KIM JH， LEE J， OH B， et al. Prediction of phosphorylation sites using svms[J]. Bioinformatics， 2004， 20（17）， 3179.
[11] TIAN M， CHEN X， XIONG Q， et al. Phosphoproteomic analysis of protein phosphorylation networks in Tetrahymena thermophila， a model single??celled organism[J]. Molecular & Cellular Proteomics， 2013， 13（2）： 503.
[12] HUNTER T. Signaling-2000 and beyond[J]. Cell， 2000， 100（1）： 113.
[13] KOMANO T， UTSUMI R， KAWAMUKAI M. Functional analysis of the fic gene involved in regulation of cell division[J]. Research in Microbiology， 1991， 142（2-3）： 269.
[14] BHATTACHARJEE RN， PARK KS， KUMAGAI Y， et al. Vp1686， a vibrio type III secretion protein， induces toll??like receptor??independent apoptosis in macrophage through nf??kappab inhibition[J]. Journal of Biological Chemistry， 2006， 281（48）， 36897-36904.
[15] YARBROUGH ML， LI Y， KINCH LN， et al. Ampylation of rho gtpases by Vibrio vops disrupts effector binding and downstream signaling[J]. Science， 2009， 323（5911）： 269-272.
[16] FIERER J， GUINEY DG. Diverse virulence traits underlying different clinical outcomes of Salmonella infection[J]. Journal of Clinical Investigation， 2001， 107（7）：775-780.
[17] MATLAWSKAWASOWSKA K， FINN R， MUSTEL A， et al. The Vibrio parahaemolyticus type III secretion systems manipulate host cell mapk for critical steps in pathogenesis[J]. BMC Microbiology， 2010， 10（1）： 1-16.
[18] SHIMOHATA T， NAKANO M， LIAN X， et al. Vibrio parahaemolyticus infection induces modulation of il??8 secretion through dual pathway via vp1680 in caco??2 cells[J]. Journal of Infectious Diseases， 2011， 203（4）： 537.
[19] XIE HX， YU HB， ZHENG J， et al. Eseg， an effector of the type III secretion system of Edwardsiella tarda， triggers microtubule destabilization[J]. Infection & Immunity， 2010， 78（12）， 5011.
Key words Vibrio alginolyticus； Type III secretory system； Effect protein； Bioinformatics analysis
Vibrio alginolyticus is a type of Gram??negative bacteria， in the shape of a short rod. It is halophilic， and has no spores and capsule[1] ， belonging to Vibrio in Vibrionaceae family. V. alginolyticus is a kind of common marine conditioned pathogen， as well as one of the main pathogens causing vibriosis in aquatic animals. V. alginolyticus could cause infectious vibriosis of fish， shrimp and shellfish in a larger scale[2]， thereby resulting in serious economic loss for aquaculture industry. Moreover， this pathogen could cause various human diseases including otitis media， diarrhea and blood poisoning[3]， thereby seriously threatening human health.
Type III secretion system （T3SS） has been ascertained to be a virulent element in the shape of a needle conservatively existing in bacteria， which activates the secretory pathway depending on the contact with host cells and infuses type III secreted system effector proteins （T3SEs） to host cells， thereby affecting normal metabolism and function of host cells and causing cytoskeleton and immune dysfunction of host cells， which further induce the death of host cells[4-5]. T3SS has become one of the research hotspots on pathogens in recent years. The research team of this study has done in??depth studies on V. alginolyticus Type III secretion system molecular chaperone and injectisome protein[6a，6b]， laying a foundation for the study on other proteins of V. alginolyticus Type III secretion system. In the preliminary study， the research team obtained the Type III secretion system effector protein Va1686， and its full length （GenBank： KX245316.1） was obtained through further sequencing and sequence alignment. In this study， in order to further study its biological function， the protein sequence of Va1686 was systematically predicted and studied by bioinformatics methods and tools.
Materials and Methods
Materials
Complete amino acid sequence of HY9901 V. alginolyticus effector protein Va1686 （GenBank： KX245316.1）， committed by the laboratory， serving as the object of study； Escherichia coli DH5??， provided by the laboratory； cloning vector pMD18??T Vector， purchased from TaKaRa （Dalian）； Easy Taq and Ex Taq， purchased from Transgen Biotech； PCR amplifier， purchased from Bio??Rad company； UNIQ??10 column type bacterial genomic Ezup Column Bacteria Genomic DNA Purification Kit.
Extraction of total DNA of V. alginolyticus
Single colonies of V. alginolyticus were cultured with TSB medium， and subjected to DNA extraction according to the instruction of DNA purification kit.
Amplification of V. alginolyticus Va1686 gene fragment
The sequence fragment encoded by Va1686 gene was amplified using following primers： forward primer V1： 5????ATGATCAGTTTTGGAAGTGTT??3??， and reverse primer V2： 5????TCACTTAAT ACCGTGAAGGCTA??3??. The PCR program was started with 94 ??for 5 min， followed by 35 cycles of 94 ?? for 45 s， 55 ?? for 45 s and 72 ?? for 90 s， and 72 ?? for 10 min， and the product was preserved at 4 ??. Then， the PCR product was subjected to electrophoresis detection， recovery of target band， ligation with pMD 18??T Vector， and transformation of ligation product. The selected clones were subjected to PCR identification， and positive clones were selected for sequencing [Sangon Biotech （Guangzhou） Co.， Ltd.].
Methods
The physicochemical properties of V. alginolyticus Va1686 protein were analyzed using ExPASy software with reference to literature[7] . The N??terminal signial peptide sequence of Va1686 protein was predicted using SignalP 4.1 Server software. Transmembrane domains were predicted using TMHMM Server 2.0 software. Subcellular localization was performed using PSORT. The potential phosphorylation sites and glycosylation sites were predicted using SoftBerry??Psite software. The amino acid sequences of other Vibrio strains similar to the studied protein were searched in NCBI using the provided BLAST online searching software. These amino acid sequences were analyzed using MEGA6.0 software by neighbor??joining method （NJ）. Multiple sequence analysis of amino acids were performed using ClustalX2 software， so as to deduce the evolutionary relationship of this protein with different strains. The secondary structure of Va1686 was predicted by Chou??Fasman method， and the hydrophilic parameter of Va1686 was predicted by Kyte??Doolittle method； the flexibility parameter was predicted by Karplus??Schulz method； the surface probability parameter of Va1686 was predicted by Emini method； and the antigenicity parameter of Va1686 was predicted by Jameson??Wolf method. The results of the various parameters were compared， and finally， the B??cell preponderant epitopes of V. alginolyticus HY9901 Va1686 protein were determined using DNAstar software according to the various parameters comprehensively. Homologous modeling of V. alginolyticus Va1686 protein was performed using SWISS??MODEL software， to predict its 3??D structure. Results and Analysis
Cloning of Va1686 gene
Through PCR amplification， a specific band at about1 164 bp was obtained （Fig. 1）. The product was ligated with the cloning vector pMD18??T， and the ligation product was sequenced by sequencing company. The Va1686 gene contains a 1 164 bp open reading frame （ORF）， and could encode 387 amino acids. The gene was submitted to GenBank， with an accession number of KX245316.
M： DNA marker DL2000； 1-3： Va1686 PCR product.
Fig. 1 PCR amplification of Va1686 gene
Physicochemical properties and sequence analysis
The physicochemical properties of V. alginolyticus Va1686 protein （Table 1） were analyzed using ExPASy （http：//web.expasy.org/protparam/） software. The molecular structural formula of Va1686 is C1798H2874N520O580S13， with a total atom number of 5 785. Va1686 is a stable hydrophilic protein with a theoretical pI value of 5.71. The protein is acidic without cysteine， pyrrolysine and selenocysteine.
The Va1618 protein was subjected to signal peptide prediction using SignalP 4.1 Server （http：//www.cbs.dtu.dk/services/SignalP/） online software， and the results show that the protein contains no significant signal peptide cleavage sites. PORST（https：//psort.hgc.jp/） subcellular localization prediction showed that Va1686 exists in cytoplasm. The prediction using TMHMM Server 2.0 （http：//www.cbs.dtu.dk/services/TMHMM??2.0/） online software shows that Va1686 contains no transmembrane domain. The prediction using SoftBerry??Psite （http：//linux1.softberry.com/berry.phtml？ topic=psite&group=programs & subgroup=proloc） online software shows that the amino acid sequence of Va1686 potentially contains two casein kinase II phosphorylation sites， three protein kinase C phosphorylation sites， six N??glycosylation sites， nine N??myristoylation sites and 12 microbodies C??terminal targeting signal sites （Fig. 2）.
The Va1686 protein sequence of V. alginolyticus HY9901 was subjected to homology comparison with other Vibrio strains including V. harveyi and V. parahaemolyticus through Blast （http：//blast.ncbi.nlm.nih.Gov/Blast.cgi）. The results show that Va1686 protein is relatively stable in Vibrio（Fig. 3）. A phylogenetic tree was built with Va1686 protein sequence of V. alginolyticus HY9901 and similar protein sequences of other Vibrio strains using MEGA 6.0 system software， and the results showed that V. alginolyticus HY9901 and V. harveyi were clustered together， indicating that the genetic relationship between the two species was closest （Fig. 4）. Prediction of function domains and higher structure of Va1686
The amino acid sequence of Va1686 protein was committed to NCBI online conserved domain database CDD （http：//www.ncbi.nlm.nih.gov/Structure/Lexingt??on/lexington.cgi） to be analyzed， and the results show that Va1686 contains a Fic superfamily conserved domain （Fig. 5）. The secondary structure of Va1686 was predicted using SOPMA （https：//npsa??prabi.ibcp. fr/cgi??bin/npsa_automat.pl？page=/NPSA/npsa_sopma.html） online software， and the results show that in the secondary structure of Va1686，alpha helix accounts for 57.62%， random coil accounts for 25.58%， extended strand accounts for 8.53%， and beta sheet accounts for 8.27% （Fig. 6）.
According to Chou??Fasman method， the secondary structure of Va1686 was mainly ????helix and ????sheet， which were mainly distributed in the regions of 3-6， 23-26， 28-31， 48-51， 59-62， 68-71， 82-85， 104-107， 123-126， 128-131， 150-153 and 174-177， and 185-192， 216-223， 234-241， 254-257， 271-274， 279-282， 295-316， 329-332， 346-349， 352-359 and 369-376， as shown in 7A. Generally， there are abundant turn structures between ????helix and ????sheet. Because turn structure is loose， these regions would be bound with antibodies easily， thereby forming epitopes.
The hydrophilcity of Va1686 was analyzed by Kyte??Doolittle method. As shown in Fig. 7B， the hydrophilic regions of Va1686 were located in the ranges of 15-52， 58-71， 80-110， 121-154， 172-177 and 180-191， and 204-224， 227-244， 252-262， 365-303， 316-338， 350-359 and 366-387.
The flexibility of Va1686 was predicted according to Karplus??Schulz method. The flexible regions were located in the regions of 16-20， 22-33， 39-51， 59-72， 82-89， 105-114， 121-133， 148-156， 160-163 and 173-178， and 183-191， 205-209， 215-222， 233-243， 252-277， 282-284， 293-316， 326-338， 351-357， 368-373 and 380-382 （Fig. 7C）. The structure of a protein depends on its flexibility to a certain degree， and the larger the flexibility， the easier the regions with higher flexibility distort， which is beneficial to the chimerism with antibodies.
The antigenicity index was predicted by Jameson??Wolf method， and there were more regions： 16-35， 42-52， 58-72， 80-93， 105-112 and 121-133， and 145-154， 171-177， 183-191， 206-212， 215-221， 228-243， 252-262， 270-279， 281-287， 292-318， 326-337， 349-358， and 367-382， which have higher antigenicity index（Fig. 7D）.
The surface probability was predicted by Emini method. The results showed that there were 17 regions in total： 15-18， 32-35， 41-49， 66-68， 82-91， 125-133， 140-142， 148-154 and 182-186， and 205-210， 253-261， 269-274， 281-284， 293-301， 327-336， 369-371 and 378-380（Fig. 7E）. Using DNAStar software， the secondary structure， hydrophilcity， flexibility， antigenicity index and surface probability were comprehensively analyzed， and the characteristics of 12 regions satisfied requirements to all above indices： 48-49， 82-85， 125-126， 150-153， 185-186， 236-237， 254-257， 271-274， 295-301， 329-332， 353-354 and 369-371. These 12 regions had higher comprehensive indices， and could be deduced to contain potential B??cell preponderant epitopes.
Prediction of tertiary structure
Homologous modeling of V. alginolyticus HY9901 Va1686 protein was performed using SWISS??MODEL （http：//swissmodel. expasy.org/） online software， obtaining the 3??D structure model of Va1686 protein subunit （Fig. 8）. The results showed that the vopS of V. parahaemolyticus was similar[8]， and the similarity was 89.46%（Fig. 8）.
Discussion
Type III secreted system effector proteins are important executors of bacterial virulence， as well as the key of the interaction between pathogens and hosts. With the Va1686 protein sequence committed to NCBI by the research team of this study as the object of study， it was found by bioinformatics analysis that Va1686 protein belongs to soluble protein without a transmembrane domain and an obvious signal peptide， which satisfies the characteristic that this type of proteins enter hosts to play their role with the need for the help of molecular chaperones， which coincides with the prediction result of subcellular localization. The secondary structure of Va1686 protein satisfies the "??+??" folding pattern[9]. This amino acid sequence contains two casein kinase II phosphorylation sites， three protein kinase C phosphorylation sites， six N??glycosylation sites， nine N??myristoylation sites and 12 microbodies C??terminal targeting signal sites. Phosphorylation is a kind of biological modification after the protein translation[10-11]， which could improve the specificity of proteins. Because V. alginolyticus contains no Golgi apparatus and endoplasmic reticulum， it could not further process the proteins obtained after translation， and could not perform modification of amidation or glycosylation. However， phosphorylation is not influenced[12]， and in future studies， the construction of mutant strains with the deletion of phosphorylation sites to further perform in??depth function analysis.
Through the alignment of protein sequences of various Vibrio strains， it was found that the Va1686 protein in Vibrio was highly similar， indicating that the protein is relatively stable in the evolutionary process of Vibrio. On the built phylogenetic tree，V. alginolyticus HY9901 was clustered together with V. harveyi， indicating that the genetic relationship between the two species was closest， which also satisfies the results of morphological and biochemical classification. Comprehensively from the prediction of B??cell preponderant epitopes and the alignment of amino acid sequences， it was speculated that Va1686 protein might be the common antigen of Vibrio， and could serve as the candidate protein of Vibrio subunit vaccine. The analysis on the structure of Va1686 protein show that the protein contains a Fic superfamily conserved domain. Fic protein belongs to Fic/DOC family， and the domain is correlated with cell division. It has been demonstrated that Fic protein could control cell division by influencing the synthesis of PAB or folic acid[13]. The 3D structure model of Va1686 subunit was simulated by SWISS??MODEL software and it was found that the vopS of V. parahaemolyticus was similar and the similarity was 89.46%.VopS （vp1686） of V. alginolyticus could inhibit the signal path of NF????B[14]， and block the binding of Rho GTP enzyme in mammalian cells with downstream signal molecules through AMPylation of the enzyme， thereby influencing the assembly of cytoskeleton， and as a result， cells became round， and finally died[15]. Therefore， whether this protein could play a role the same as or similar to VopS in host cells will be the emphasis of future research.
In this study， the type III secreted system effector protein Va1686 of V. alginolyticus was subjected to bioinformatics analysis， and the secondary structure， 3D structure， conserved domains and B??cell preponderant epitopes of the protein were predicted and analyzed， with an attempt to lay a foundation for the profound understanding of the action mechanism between type III secreted system effector protein and host cells. This study laid a foundation for further research and development of vaccine.
References
[1] H?ZRMANSDORFER S， WENTGES H， NEUGEBAURB¨?CHLER K， et al. Isolation of Vibrio alginolyticus from seawater aquaria[J]. International Journal of Hygiene & Environmental Health， 2000， 203（2）， 169-175.
[2] SADOK K， MEJDI S， NOURHEN S， et al. Phenotypic characterization and rapd fingerprinting of Vibrio parahaemolyticus and Vibrio alginolyticus isolated during tunisian fish farm outbreaks[J]. Folia Microbiologica， 2013， 58（1）， 17-26.
[3] SGANGA G， COZZA V， SPANU T， et al. Global climate change and wound care： case study of an off??season Vibrio alginolyticus infection in a healthy man[J]. Ostomy/wound Management， 2009， 55（4）： 60-62.
[4] BURDETTE DL， SEEMANN J， ORTH K. Vibrio VopQ induces PI3??kinase??independent autophagy and antagonizes phagocytosis[J]. Molecular Microbiology， 2009， 73（4）：639-649.
[5] PANG HY， QIU M， ZHAO J， et al. Construction of a Vibrio alginolyticus hopPmaJ （hop） mutant and evaluation of its potential as a live attenuated vaccine in orange??spotted grouper （Epinephelus coioides）[J]. Fish Shellfish Immunol， 2018， 76（5）： 93-100. [6a] PANG HY， ZHOU ZJ， DING Y， et al. Molecular Cloning and Bioinformatics Analysis of T3SS Chaperone Escort Protein VscO from Vibrio alginolyticus[J]. Biotechnology Bulletin， 2014 （6）： 155-161.
[6b] PANG HY， ZHOU ZJ， DING Y， et al. Prokaryotic expression and immunogenicity of the type III secretion system injectisome protein VscO from Vibrio alginolyticus， Guangdong Haiyangdaxue Xuebao[J]. Journal of Guangdong Ocean University， 2014， 34（3）， 41-46.
[7] WILKINS MR， GASTEIGER E， BAIROCH A， et al. Protein identification and analysis tools in the expasy server[J]. Methods in Molecular Biology， 1999， 112（112）： 531-552.
[8] ONO T， PARK KS， UETA M， IIDA T， et al. Identification of proteins secreted via Vibrio parahaemolyticus type III secretion system 1[J]. Infection & Immunity， 2006， 74（2）： 1032-42
[9] MURZIN AG， BRENNER SE， HUBBARD T， et al. SCOP： A structural classification of proteins for the investigation of sequences and structures[J]. Journal of Molecular Biology， 1995（247）： 536-540.
[10] KIM JH， LEE J， OH B， et al. Prediction of phosphorylation sites using svms[J]. Bioinformatics， 2004， 20（17）， 3179.
[11] TIAN M， CHEN X， XIONG Q， et al. Phosphoproteomic analysis of protein phosphorylation networks in Tetrahymena thermophila， a model single??celled organism[J]. Molecular & Cellular Proteomics， 2013， 13（2）： 503.
[12] HUNTER T. Signaling-2000 and beyond[J]. Cell， 2000， 100（1）： 113.
[13] KOMANO T， UTSUMI R， KAWAMUKAI M. Functional analysis of the fic gene involved in regulation of cell division[J]. Research in Microbiology， 1991， 142（2-3）： 269.
[14] BHATTACHARJEE RN， PARK KS， KUMAGAI Y， et al. Vp1686， a vibrio type III secretion protein， induces toll??like receptor??independent apoptosis in macrophage through nf??kappab inhibition[J]. Journal of Biological Chemistry， 2006， 281（48）， 36897-36904.
[15] YARBROUGH ML， LI Y， KINCH LN， et al. Ampylation of rho gtpases by Vibrio vops disrupts effector binding and downstream signaling[J]. Science， 2009， 323（5911）： 269-272.
[16] FIERER J， GUINEY DG. Diverse virulence traits underlying different clinical outcomes of Salmonella infection[J]. Journal of Clinical Investigation， 2001， 107（7）：775-780.
[17] MATLAWSKAWASOWSKA K， FINN R， MUSTEL A， et al. The Vibrio parahaemolyticus type III secretion systems manipulate host cell mapk for critical steps in pathogenesis[J]. BMC Microbiology， 2010， 10（1）： 1-16.
[18] SHIMOHATA T， NAKANO M， LIAN X， et al. Vibrio parahaemolyticus infection induces modulation of il??8 secretion through dual pathway via vp1680 in caco??2 cells[J]. Journal of Infectious Diseases， 2011， 203（4）： 537.
[19] XIE HX， YU HB， ZHENG J， et al. Eseg， an effector of the type III secretion system of Edwardsiella tarda， triggers microtubule destabilization[J]. Infection & Immunity， 2010， 78（12）， 5011.