论文部分内容阅读
Abstract AP2/ERF transcription factor is a kind of plantspecific transcription factor， which is widely involved in the whole process of plant growth and development， and has important regulatory effects in plant secondary metabolism. In this study， the CaERF gene was cloned from Capsicum annuum by RTPCR. The bioinformatics and expression analysis revealed that the CDS region of this gene is 795 bp in length， encoding 264 amino acids， and the molecular weight and isoelectric point of the protein are 30.1 KD and 5.74， respectively; the gene encodes a 58amino acid DNAbinding domain AP2 at 533-706， which is closest to Capsicum chinense in genetics; and the gene is expressed early in the fruit development from 16 to 20 d after flowering， and related to the level of pun1 gene expression. The cloning and expression analysis of CaERF transcription factor gene laid a foundation for further study on the regulation of capsaicin synthesis.
Key words Capsaicin; CaERF gene; Gene cloning; mRNA expression
The AP2/ERF transcription factor is a plantspecific transcription factor with a DNAbinding domain AP2 of 60-70 amino acids that can bind to ciselements such as DRE， GCCbox and CAACA motifs[3]. According to the number and structure of DNA binding domains， the AP2/ERF gene family can be divided into three subfamilies （AP2， ERF and RAV） and one individual member Soloist[4]. The AP2/ERF family is not only involved in a variety of biotic and abiotic stress responses in plants[5-6]， but also an important factor in the ability of plant fruits to mature and form various quality traits. It is known that AP2/ERF gene family members participate and play important roles in the processes of citrus degreening[7]， banana ripening[8]， postharvest softening of persimmon[9]and capsicum fruit development[10].
Capsicum （Capsicum spp.） has become an important vegetable and condiment because of its unique spicy taste[11]， and capsaicinoids have medical and health care effects including anticancer， analgesic and weightreducing effects[12-15]. At present， there have been many reports on the functional genes of capsaicin biosynthesis pathway， but studies on the regulation of capsaicin synthesis have rarely been reported.
Based on the published genome sequence information of capsicum， the fulllength cDNA sequence of CaERF gene was obtained by RTPCR and analyzed by bioinformatics， and the expression pattern of CaERF gene in the development of different cultivars was analyzed by realtime quantitative PCR. This study provides a reference for elucidating the regulation mechanism of the gene in the formation of capsicum flavor. Materials and Methods
Experiment materials
The test materials were such three capsicum cultivars as Capsicum annuum， Capsicum frutescens and Capsicum Chinense， the fruits of which were collected at 16， 18， 20， 22， 24 and 26 d after flowering and immediately cut on ice into small pieces， which were quickly frozen with liquid nitrogen and put in an ultralow temperature refrigerator at -80 ℃ for storage.
Cloning and sequencing of CaERF gene
PCR amplification primers were designed based on published capsicum genome sequence information as follows： CaERFF： AAAAGAGATCGAATTCATGTGTGGTGGAGCAATTCT and CaERFR： GGATCCGTCGACCTGCTCAAACTACATTATAACTAG. The placental RNA of capsicum was extracted with the TaKaRa plant RNA extraction kit， and its cDNA was obtained using the TaKaRa PrimeScriptTM1st Strand cDNA Synthesis Kit through reverse transcription. PCR amplification was carried out using the cDNA as a template. The amplification was started with predenaturation at 98 ℃for 2 min， followed by 30 cycles of 98 ℃ for 10 s， 55 ℃ for 15 s， and 72 ℃ for 1 min， and extension at 72 ℃ for 10 min. The amplification product was detected by agarose gel electrophoresis. The recovered product was ligated into the pGAD424 vector using the pEASYUniAeamless Clonging and Assembly Kit and transferred to Escherichia coli DH5α. Positive clones were identified and sent to Sangon Biotech （Shanghai） Co.， Ltd. for sequencing.
Bioinformatics analysis of CaERF gene
The fulllength mRNA sequence of CaERF obtained by sequencing was subjected to BLAST alignment by NCBI. The molecular weight and isoelectric point of the CaERF protein were predicted by web.expasy.org/cgibin/proparam/proparam. The domains of CaERF gene were analyzed by http：//www.athamap.de/search_gene.ph. And the phylogenetic tree analysis of plant CaERF proteins was performed using DNAMAN6.0 software combined with the protein database on the NCBI website.
Analysis of CaERF gene by qRTPCR
According to the mRNA sequence of CaERF gene， primers were designed as qerfF： TATTTTTCGGTTTAGGAGAATGG and qerfR： TTTGAAGACAAAATAGGGCAATG. The three cultivars were extracted for RNA at 16， 18， 22， 24 and 26 d， respectively. Reverse transcription was performed using PrimeScripTM1st Stand Cdna Synthesis Kit （TaKaRa）， and with βactin as an internal reference gene， realtime RTPCR was performed according to SYBR Premix Ex TaqTM（TliRNaseH Plus）. Each sample was done with 3 replicates to calculate the standard deviation. The data processing formula was the relative expression of mRNA = 2-△△Ct， where △△Ct = （Ctvalue of the test group-Ct value of the internal reference of the test group）-（Average Ct value of the control groupAverage Ct value of the internal reference of the control group）. Results and Analysis
Cloning of CaERF gene
A band of about 750 bp was observed after RTPCR which used the CaERFF and CaERFR primers with the cDNA obtained through the reverse transcription of RNA extracted from C. annuum placenta as a template （Fig. 1）. The sequencing results showed that the CaERF gene was 795 bp in length and contained a complete reading frame， which was predicted to encode 264 amino acids （Fig. 3）. The start codon was ATG and the stop codon was TGA.
Bioinformatics Analysis of CaERF Gene
The molecular weight and isoelectric point of CaERF protein were predicted to be 30.1 KD and 5.74 by web.expasy.org/cgibin/proparam/proparam， respectively. Analysis by http：//www.athamap.de/search_gene.php revealed that the CaERF gene sequence encodes a 58amino acid DNAbinding domain AP2 domain at 533-706 （Fig. 3）， presumably the EFR gene.
The phylogenetic analysis of the CaERF proteins and the ERF proteins in other plant species using MEGA 5.0 software and the protein database on the NCBI website revealed that they are homologously expressed in other species such as tomato， tobacco， cucumber， morning glory， persimmon， jatropha and rose， and are closest to C. chinense in genetics （Fig. 4）.
Analysis of CaERF gene expression
The realtime RTPCR showed that the CaERF gene was expressed early in the fruit development from 16 to 20 d after flowering， which was consistent with the expression pattern of the key gene pun1 for capsaicin synthesis. It is speculated that CaERF is involved in the regulation of capsaicin biosynthesis （Fig.5， Fig. 6， Fig. 7）.
Discussion
AP2/ERF transcription factor is a kind of plantspecific transcription factor， which is an important factor for plant fruit ripening and formation of various quality traits. For instance， it plays an important role in the processes of citrus degreening， banana ripening， postharvest softening of persimmon and quality formation of capsicum fruit.
Capsaicin and dihydrocapsaicin are the main active constituents of capsaicinoids， and their content directly affects the quality of capsicum. The regulation of its synthesis is of great significance for improving the quality of capsicum. However， there are few studies on the regulation of capsaicin synthesis relative to the study of capsaicin synthesis functional genes[16-17]. Therefore， exploring and studying the regulatory genes that regulate capsaicin synthesis and elucidating their function can provide important genetic resources and theoretical references for molecular breeding to increase capsaicin content. In view of this， this study cloned the CaERF gene and performed bioinformatics prediction on it. It was predicted to contain a 58amino acid DNAbinding domain AP2 domain， which is closest to the ERF gene of C. chinense in genetics. The expression pattern analysis showed that CaERF gene was expressed in the early developmental stages of C. annuum， C. frutescens and C. chinense fruits， which is consistent with the expression pattern of pun1 gene， indicating that this gene plays an important role in the synthesis of capsaicin in capsicum fruit， which is consistent with the results reported by Keyhaninejad[10]. The above results provide a theoretical basis for further study of CaERF gene function， the indepth exploration of downstream target regulatory genes， and for the study of the molecular mechanism of the target protein in activating its downstream target gene expression by sitedirected mutagenesis.
References
[1] STOCKINGER EJ， GILMOUR SJ， THOMASHOW MF. Arabidopsis thaliana CBF1 encodes an AP2 domaincontaining transcriptional activator that binds to the Crepeat/DRE， a cisactingDNA regulatory element that stimulates transcription in response to low temperature and water deficit[J]. Proceedings of the National Academy of Sciences of the United States of America， 1997， 94（3）： 1035-1040.
[2] OHMETAKAGI M， SHINSHI H. Ethylene inducible DNA binding proteins that interact with an ethylene responsive element[J]. Plant Cell， 1995， 7（2）： 173-182.
[3] KAGAYA Y， OHMIYA K， HATTORI T. RAV1， a novel DNAbinding protein， binds to bipartite recognition sequence through two distinct DNAbinding domains uniquely found in higher plants[J]. Nucleic Acids Research， 1999， 27（2）： 470-478.
[4] NAKANO T， SUZUKI K， FUJIMURA T， SHINSHI H. Genomewide analysis of the ERF gene family in Arabidopsis and rice[J].Plant Physiology， 2006， 140（2）： 411-432.
[5] PARK JM， PARK CJ， LEE SB， et al. Overexpression of the tobacco Tsi1 gene encoding an EREBP/AP2type transcription factor enhances resistance against pathogen attack and osmotic stress in tobacco[J]. Plant Cell， 2001， 13（5）： 1035-1046.
[6] ZHANG GY， CHEN M， LI LC， et al. Overexpression of the soybean GmERF3 gene， an AP2/ERF type transcription factor for increased tolerances to salt， drought， and diseases in transgenic tobacco[J]. Journal of Experimental Botany， 2009， 60（13）： 3781-3796.
[7] YIN XR， XIE XX， XIA XJ， et al. Involvement of an ethylene response factor in chlorophyll degradation during citrus fruit degreening[J]. Plant Journal， 2016， 86（5）： 403-412. [8] XIAO YY， CHEN JY， KUANG JF， et al. Banana ethylene response factors are involved in fruit ripening through their interactions with ethylene biosynthesis genes[J]. Journal of Experimental Botany， 2013， 64（8）： 2499-2510.
[9] WANG MM， ZHU QG， DENG CL， et al. Hypoxiaresponsive ERFs involved in postdeastringency softening of persimmon fruit[J]. Plant Biotechnology Journal， 2017， 15（11）： 1409-1419.
[10] KEYHANINEJAD N， CURRY J， ROMERO J， et al. Fruit specific variability in capsaicinoid accumulation and transcription of structural and regulatory genes in Capsicum fruit[J]. Plant Sci， 2014， （215-216）： 59-68.
[11] Bosland P W ， Votava E J . Peppers： Vegetable and Spice Capsicums[J]. Cabi Bookshop， 2000， 2：14-39.
[12] LUO XJ， PENG J， LI YJ. Recent advances in the study on capsaicinoids and capsinoids[J]. Eur J Pharmacol， 2011， 650 （1）： 1-7.
[13] LUDY MJ， MOORE GE， MATTES RD. The effects of capsaicin and capsiate on energy balance：Critical review and metaanalyses of studies in humans[J]. Chem Senses， 2012， 37 （2）： 103-121.
[14] Capsaicin induces apoptosis in human small cell lung cancer via the TRPV6 receptor and the calpain pathway[J]. Apoptosis， 2014， 19（8）：1190-1201.
[15] WHITING S， DERBYSHIRE EJ， TIWARI B. Could capsaicinoids help to support weight management？ A systematic review and metaanalysis of energy intake data[J]. Appetite， 2014， 73： 183-188.
[16] HAN K， JEONG HJ， SUNG J， et al. Biosynthesis of capsinoid is controlled by the Pun1 locus in pepper[J]. Mol Breeding， 2013， 31： 537-548.
[17] KOBATA K， SUGIWARA M， MIURA M， et al .Potent production of capsaicinoids and capsinoids by Capsicum peppers[J]. J Agri Food Chem， 2013， 61： 11127-11132.
Editor： Yingzhi GUANG Proofreader： Xinxiu ZHU
Key words Capsaicin; CaERF gene; Gene cloning; mRNA expression
The AP2/ERF transcription factor is a plantspecific transcription factor with a DNAbinding domain AP2 of 60-70 amino acids that can bind to ciselements such as DRE， GCCbox and CAACA motifs[3]. According to the number and structure of DNA binding domains， the AP2/ERF gene family can be divided into three subfamilies （AP2， ERF and RAV） and one individual member Soloist[4]. The AP2/ERF family is not only involved in a variety of biotic and abiotic stress responses in plants[5-6]， but also an important factor in the ability of plant fruits to mature and form various quality traits. It is known that AP2/ERF gene family members participate and play important roles in the processes of citrus degreening[7]， banana ripening[8]， postharvest softening of persimmon[9]and capsicum fruit development[10].
Capsicum （Capsicum spp.） has become an important vegetable and condiment because of its unique spicy taste[11]， and capsaicinoids have medical and health care effects including anticancer， analgesic and weightreducing effects[12-15]. At present， there have been many reports on the functional genes of capsaicin biosynthesis pathway， but studies on the regulation of capsaicin synthesis have rarely been reported.
Based on the published genome sequence information of capsicum， the fulllength cDNA sequence of CaERF gene was obtained by RTPCR and analyzed by bioinformatics， and the expression pattern of CaERF gene in the development of different cultivars was analyzed by realtime quantitative PCR. This study provides a reference for elucidating the regulation mechanism of the gene in the formation of capsicum flavor. Materials and Methods
Experiment materials
The test materials were such three capsicum cultivars as Capsicum annuum， Capsicum frutescens and Capsicum Chinense， the fruits of which were collected at 16， 18， 20， 22， 24 and 26 d after flowering and immediately cut on ice into small pieces， which were quickly frozen with liquid nitrogen and put in an ultralow temperature refrigerator at -80 ℃ for storage.
Cloning and sequencing of CaERF gene
PCR amplification primers were designed based on published capsicum genome sequence information as follows： CaERFF： AAAAGAGATCGAATTCATGTGTGGTGGAGCAATTCT and CaERFR： GGATCCGTCGACCTGCTCAAACTACATTATAACTAG. The placental RNA of capsicum was extracted with the TaKaRa plant RNA extraction kit， and its cDNA was obtained using the TaKaRa PrimeScriptTM1st Strand cDNA Synthesis Kit through reverse transcription. PCR amplification was carried out using the cDNA as a template. The amplification was started with predenaturation at 98 ℃for 2 min， followed by 30 cycles of 98 ℃ for 10 s， 55 ℃ for 15 s， and 72 ℃ for 1 min， and extension at 72 ℃ for 10 min. The amplification product was detected by agarose gel electrophoresis. The recovered product was ligated into the pGAD424 vector using the pEASYUniAeamless Clonging and Assembly Kit and transferred to Escherichia coli DH5α. Positive clones were identified and sent to Sangon Biotech （Shanghai） Co.， Ltd. for sequencing.
Bioinformatics analysis of CaERF gene
The fulllength mRNA sequence of CaERF obtained by sequencing was subjected to BLAST alignment by NCBI. The molecular weight and isoelectric point of the CaERF protein were predicted by web.expasy.org/cgibin/proparam/proparam. The domains of CaERF gene were analyzed by http：//www.athamap.de/search_gene.ph. And the phylogenetic tree analysis of plant CaERF proteins was performed using DNAMAN6.0 software combined with the protein database on the NCBI website.
Analysis of CaERF gene by qRTPCR
According to the mRNA sequence of CaERF gene， primers were designed as qerfF： TATTTTTCGGTTTAGGAGAATGG and qerfR： TTTGAAGACAAAATAGGGCAATG. The three cultivars were extracted for RNA at 16， 18， 22， 24 and 26 d， respectively. Reverse transcription was performed using PrimeScripTM1st Stand Cdna Synthesis Kit （TaKaRa）， and with βactin as an internal reference gene， realtime RTPCR was performed according to SYBR Premix Ex TaqTM（TliRNaseH Plus）. Each sample was done with 3 replicates to calculate the standard deviation. The data processing formula was the relative expression of mRNA = 2-△△Ct， where △△Ct = （Ctvalue of the test group-Ct value of the internal reference of the test group）-（Average Ct value of the control groupAverage Ct value of the internal reference of the control group）. Results and Analysis
Cloning of CaERF gene
A band of about 750 bp was observed after RTPCR which used the CaERFF and CaERFR primers with the cDNA obtained through the reverse transcription of RNA extracted from C. annuum placenta as a template （Fig. 1）. The sequencing results showed that the CaERF gene was 795 bp in length and contained a complete reading frame， which was predicted to encode 264 amino acids （Fig. 3）. The start codon was ATG and the stop codon was TGA.
Bioinformatics Analysis of CaERF Gene
The molecular weight and isoelectric point of CaERF protein were predicted to be 30.1 KD and 5.74 by web.expasy.org/cgibin/proparam/proparam， respectively. Analysis by http：//www.athamap.de/search_gene.php revealed that the CaERF gene sequence encodes a 58amino acid DNAbinding domain AP2 domain at 533-706 （Fig. 3）， presumably the EFR gene.
The phylogenetic analysis of the CaERF proteins and the ERF proteins in other plant species using MEGA 5.0 software and the protein database on the NCBI website revealed that they are homologously expressed in other species such as tomato， tobacco， cucumber， morning glory， persimmon， jatropha and rose， and are closest to C. chinense in genetics （Fig. 4）.
Analysis of CaERF gene expression
The realtime RTPCR showed that the CaERF gene was expressed early in the fruit development from 16 to 20 d after flowering， which was consistent with the expression pattern of the key gene pun1 for capsaicin synthesis. It is speculated that CaERF is involved in the regulation of capsaicin biosynthesis （Fig.5， Fig. 6， Fig. 7）.
Discussion
AP2/ERF transcription factor is a kind of plantspecific transcription factor， which is an important factor for plant fruit ripening and formation of various quality traits. For instance， it plays an important role in the processes of citrus degreening， banana ripening， postharvest softening of persimmon and quality formation of capsicum fruit.
Capsaicin and dihydrocapsaicin are the main active constituents of capsaicinoids， and their content directly affects the quality of capsicum. The regulation of its synthesis is of great significance for improving the quality of capsicum. However， there are few studies on the regulation of capsaicin synthesis relative to the study of capsaicin synthesis functional genes[16-17]. Therefore， exploring and studying the regulatory genes that regulate capsaicin synthesis and elucidating their function can provide important genetic resources and theoretical references for molecular breeding to increase capsaicin content. In view of this， this study cloned the CaERF gene and performed bioinformatics prediction on it. It was predicted to contain a 58amino acid DNAbinding domain AP2 domain， which is closest to the ERF gene of C. chinense in genetics. The expression pattern analysis showed that CaERF gene was expressed in the early developmental stages of C. annuum， C. frutescens and C. chinense fruits， which is consistent with the expression pattern of pun1 gene， indicating that this gene plays an important role in the synthesis of capsaicin in capsicum fruit， which is consistent with the results reported by Keyhaninejad[10]. The above results provide a theoretical basis for further study of CaERF gene function， the indepth exploration of downstream target regulatory genes， and for the study of the molecular mechanism of the target protein in activating its downstream target gene expression by sitedirected mutagenesis.
References
[1] STOCKINGER EJ， GILMOUR SJ， THOMASHOW MF. Arabidopsis thaliana CBF1 encodes an AP2 domaincontaining transcriptional activator that binds to the Crepeat/DRE， a cisactingDNA regulatory element that stimulates transcription in response to low temperature and water deficit[J]. Proceedings of the National Academy of Sciences of the United States of America， 1997， 94（3）： 1035-1040.
[2] OHMETAKAGI M， SHINSHI H. Ethylene inducible DNA binding proteins that interact with an ethylene responsive element[J]. Plant Cell， 1995， 7（2）： 173-182.
[3] KAGAYA Y， OHMIYA K， HATTORI T. RAV1， a novel DNAbinding protein， binds to bipartite recognition sequence through two distinct DNAbinding domains uniquely found in higher plants[J]. Nucleic Acids Research， 1999， 27（2）： 470-478.
[4] NAKANO T， SUZUKI K， FUJIMURA T， SHINSHI H. Genomewide analysis of the ERF gene family in Arabidopsis and rice[J].Plant Physiology， 2006， 140（2）： 411-432.
[5] PARK JM， PARK CJ， LEE SB， et al. Overexpression of the tobacco Tsi1 gene encoding an EREBP/AP2type transcription factor enhances resistance against pathogen attack and osmotic stress in tobacco[J]. Plant Cell， 2001， 13（5）： 1035-1046.
[6] ZHANG GY， CHEN M， LI LC， et al. Overexpression of the soybean GmERF3 gene， an AP2/ERF type transcription factor for increased tolerances to salt， drought， and diseases in transgenic tobacco[J]. Journal of Experimental Botany， 2009， 60（13）： 3781-3796.
[7] YIN XR， XIE XX， XIA XJ， et al. Involvement of an ethylene response factor in chlorophyll degradation during citrus fruit degreening[J]. Plant Journal， 2016， 86（5）： 403-412. [8] XIAO YY， CHEN JY， KUANG JF， et al. Banana ethylene response factors are involved in fruit ripening through their interactions with ethylene biosynthesis genes[J]. Journal of Experimental Botany， 2013， 64（8）： 2499-2510.
[9] WANG MM， ZHU QG， DENG CL， et al. Hypoxiaresponsive ERFs involved in postdeastringency softening of persimmon fruit[J]. Plant Biotechnology Journal， 2017， 15（11）： 1409-1419.
[10] KEYHANINEJAD N， CURRY J， ROMERO J， et al. Fruit specific variability in capsaicinoid accumulation and transcription of structural and regulatory genes in Capsicum fruit[J]. Plant Sci， 2014， （215-216）： 59-68.
[11] Bosland P W ， Votava E J . Peppers： Vegetable and Spice Capsicums[J]. Cabi Bookshop， 2000， 2：14-39.
[12] LUO XJ， PENG J， LI YJ. Recent advances in the study on capsaicinoids and capsinoids[J]. Eur J Pharmacol， 2011， 650 （1）： 1-7.
[13] LUDY MJ， MOORE GE， MATTES RD. The effects of capsaicin and capsiate on energy balance：Critical review and metaanalyses of studies in humans[J]. Chem Senses， 2012， 37 （2）： 103-121.
[14] Capsaicin induces apoptosis in human small cell lung cancer via the TRPV6 receptor and the calpain pathway[J]. Apoptosis， 2014， 19（8）：1190-1201.
[15] WHITING S， DERBYSHIRE EJ， TIWARI B. Could capsaicinoids help to support weight management？ A systematic review and metaanalysis of energy intake data[J]. Appetite， 2014， 73： 183-188.
[16] HAN K， JEONG HJ， SUNG J， et al. Biosynthesis of capsinoid is controlled by the Pun1 locus in pepper[J]. Mol Breeding， 2013， 31： 537-548.
[17] KOBATA K， SUGIWARA M， MIURA M， et al .Potent production of capsaicinoids and capsinoids by Capsicum peppers[J]. J Agri Food Chem， 2013， 61： 11127-11132.
Editor： Yingzhi GUANG Proofreader： Xinxiu ZHU