论文部分内容阅读
Abstract [Objectives]This study was conducted to obtain actinomycetes strains having antagonistic effect on Ustilago scitaminea Syd.
[Methods]At first， actinomycetes strains were isolated from 22 soil samples in Hainan sugarcane regions. Then， antagonistic actinomycetes against U. scitaminea were screened by confrontation culture. Finally， the taxonomic status of antagonistic actinomycetes was determined using 16S rDNA.
[Results]From the 22 samples， 984 actinomycetes strains were isolated. From all the isolated strains， 23 antagonistic actinomycetes strains were obtained through primary screening， and one strains with better antagonistic effect was then obtained through secondary screening， and designated FAS. 16S rDNA identification showed that strain FAS shared 99% sequence similarity with Streptomyces cealestis US24. A phylogenetic tree was built with MAGE 7.0 software， and the results showed that strain FAS had the shortest genetic distance with S. caelestis US24. Therefore， the actinomycetes FAS was determined as S. caelestis.
[Conclusions]This study provides a new biocontrol method for the biological control of sugarcane smut， thereby ensuring sustainable development of sugarcane industry and sugar industry.
Key words Sugarcane smut； 16S rDNA identification； Streptomyces caelestis； Antagonistic effect
Sugarcane smut was found and reported for the first time in Natal， South Africa， in 1877[1]. It is caused by Ustilago scitaminea Syd.， which could disease sugarcane in sugarcane regions around the world， thereby seriously affecting the yield and quality of sugarcane[2]. In order to effectively control the occurrence of sugarcane smut， scholars have conducted studies on the biological control of sugarcane smut. At abroad， Sinha et al.[3]and Vaishnav et al.[4]studied the fungal antagonistic effect against sugarcane smut， and concluded that four fungi had the development potential of biological control. In China， Zhang et al. [5]studied the antagonistic bacteria against sugarcane smut in 2002， and Xiong et al.[6-7]studied the antagonistic bacteria HAS against sugarcane smut in 2013. Through pot experiments and field experiments， the efficacy was investigated， and the results showed that the antagonistic bacteria HAS had very good inhibiting effect on sugarcane smut. Furthermore， Xiong et al.[8]successfully isolated during studying the antibacterial mechanism of Bacillus subtilis HAS， a kind of new antibacterial protein， thereby providing an antigen material for the experimental research about transgenic sugarcane breeding. There have been many studies on the biocontrol of different pathogenic bacteria relating to antagonistic actinomycetes. Valois et al.[9]reported the antagonistic effect of actinomycetes on Xanthomonas fragariae in 1996. In 2010， Patil et al.[10]published their study about the antagonistic effect of antagonistic actinomycetes on Rhizoctonia solani， in which they successfully screened nine actinomycetes strains with better antagonism. Xiong et al.[11]conducted a study on the biocontrol of R. solanacearum using antagonistic actinomycetes in 2014. In 2015， Lai et al.[12]studied the antagonistic actinomycetes against Xinjiang cotton Verticillium wilt. Fan et al.[13]studied the antagonistic effect of antagonistic actinomycetes on Macrophoma kuwatsukai. The fermentation liquids of these antagonistic actinomycetes have remarkable inhibiting effect on pathogenic bacteria， with very good development potential for biocontrol.
In this study， actinomycetes strains were isolated from soil in sugarcane regions， and antagonistic actinomycetes against U. scitaminea was obtained through screening. The research results will provide a new biocontrol method for the biological control of sugarcane smut， thereby ensuring sustainable development of sugarcane industry and sugar industry.
Materials and Methods
Strains
The target strain， U. scitaminea Syd. was persevered in laboratory.
Sample acquisition
The rhizosphere soil of sugarcane was collected from the sugarcane regions in Hainan. All the collected samples were numbered， and the soil type， sampling location， sampling time and location information were recorded （Table 1）.
Methods
Isolation， purification and preservation of soil actinomycetes
According to references[9-13]， the collected soil samples were airdried and sieved with a 2 mm standard sieve. Then， 5 g of each sample was weighed and added into a 250 ml triangular flask filled with 1 00 ml of sterile water. The triangular flask was vibrated on a shaker for 30 min and stood for a period of time. From the triangular flask， 100 μl of the suspension was pipetted into a 2 ml centrifuge tube filled with 900 μl of sterile water， followed by mixing well. The diluted suspension was then diluted sequentially to 10-7. For each gradient dilution， 100 μl was pipetted and coated onto a GAUZE’s medium plate with a sterile coating rod， and three replicates were done. The plates were inverted and placed in an incubator at 28 ℃ for 5-7 d. For the various samples， isolation was performed， followed by counting. Meanwhile， through observation， actinomycetes strains， which differed in size， morphology and color， were picked and inoculated on new GAUZE’s medium plates， for purification and culture and preservation. Screening of antagonistic actinomycetes
Antagonistic strains were screened by point inoculation method. At first， 1 ml of the U. scitaminea suspension and improved PDA medium were mixed and uniformly added into a plate. After the medium was solidified， a purified actinomycetes strain was picked with a sterile toothpick and inoculated. The plate was inverted and placed in an incubator at 28 ℃. The inoculated strains were cultured for 3-7 d， and the experimental phenomena were observed and recorded.
16S rDNA identification of antagonistic actinomycetes FAS
According to references[9-13]， the genomic DNA of actinomycetes FAS was extracted， and amplification was performed using universal primers 27F： 5′AGAGTTTGATCCTGGCTCAG3′ and 1492R： 5′ACGGCTACCTTGTTACGACT3′. The amplification product was subjected to gel extraction， and the recovered product was ligated to vector pMD19T and transformed to Escherichia coli DH5α competent cells. Positive clones were subjected to PCR identification after selection and culture， and finally transported to Sangon Biotech （Shanghai） Co.， Ltd. for sequencing.
Analysis of sequencing results and Determination of taxonomic status of strain FAS
The sequences obtained after sequencing were aligned in NCBI after the removal of the vector sequence. Meanwhile， different strain information was selected， and a phylogenetic tree was constructed with MAGE7.0 software， to determine the taxonomic status of strain FAS.
Results and Analysis
Isolation， purification and preservation of actinomycetes in soil samples
The collected samples were subjected to serial dilution and plate isolation， and after counting and calculation， it could be known that the actinomycetes content in the soil of the sugarcane regions in Hainan was 3.7×104-4.8×106 cfu/g dry soil. The actinomycetes content was the lowest （3.7×104 cfu） in the sandy loam of Haiwei Town， Changjiang County， and the highest （4.8×106 cfu） in the sandy loam of Bohou Town， Lingao County. The actinomycetes was mostly 105 in different types of soils in various areas （Table 1）. According to colony size， morphology and color， 984 actinomycetes strains were purified and preserved.
Screening of antagonistic actinomycetes
With U. scitaminea as the target strain， antibacterial tests were conducted on the 984 actinomycetes strains by point inoculation method， and 23 actinomycetes strains having inhibiting effect on U. scitaminea were screened. Secondary screening was performed through confrontation culture tests， and an actinomycetes strain with better antagonistic effect on U. scitaminea was obtained （Fig. 1）. It had remarkable antibacterial effect， with an inhibitory zone diameter of 21 mm. This strain was designated FAS. 6S rDNA identification of strain FAS and determination of its taxonomic status
The genomic DNA of strain FAS was extracted， and amplification was performed using universal primers. After gel extraction， transformation and removal of vector， a 1 491 bp sequence was obtained. The sequence is given as below （Fig.2）
BLAST alignment in NCBI showed that the sequence shared 99% similarity with the sequence of Streptomyces caelestis， and the strain was preliminarily identified as S. caelestis. A phylogenetic tree was built with MAGE 7.0 software using 13 strains with following accession numbers： GU045531.1， LC128333.1， KX777603.1， KY628828.1， KF804152.1， GU045531.1， JQ358578.1， JX204833.1， FJ842610.1， JQ358565.1， AY875718.1， AM889494.1 and CP015849.1 （Fig. 3）. The results showed that strain FAS had the shortest genetic distance with S. caelestis US24. Therefore， the antagonistic actinomycetes FAS was determined as S. caelestis.
Conclusions and Discussion
In this study， rhizosphere soil was collected from the sugarcane fields in main sugarcane regions in Hainan Province， and an actinomycetes strain with better antagonistic effect was obtained through isolation and screening， and designated FAS. The strain was subjected to 16S rDNA identification and sequence alignment in NCBI. The alignment results showed that strain FAS shared 99% sequence similarity with S. cealestis US24. A phylogenetic tree was built with MAGE 7.0 software， and the results showed that strain FAS had the shortest genetic distance with S. caelestis US24. Therefore， the actinomycetes FAS was determined as S. caelestis.
In this study， the antagonistic actinomycetes FAS was only preliminarily identified as S. caelestis through 16S rDNA at molecular level， without doing any further physiological and biochemical experiments. The active components also need further study. However， the antagonistic actinomycetes FAS against U. scitaminea was successfully screened， which supports actinomycetes as the biocontrol strains for sugarcane smut. Actinomycetes FAS becomes a potential strain for the control of sugarcane smut.
References
[1]LU WJ， LI WF， HUANG YK. Research advances on sugarcane smut disease occurrence and control[J]. Sugar Crops of China， 2008， 2008（3）： 64-66.
[2]RILEY IT， JUBB TF， EGAN BT， et al. First outbreak of sugarcane smut in Australia[C]. Xxiii Issct Congress， New Delhi， India， 1999（2）： 22-26.
[3]SINHA OK， SINGH K. Antagonistic activity of Fusarium moniliforme var. sub. glutinans against sugarcane smut[J]. Indian Phytopathology， 1983： 92-94. [4]VAISHNAV MU， SABALPARA AN， KHANDAR RR. Mycoparasitism on sugarcane smut （Ustilago scitaminea Syd.） by four fungi[J]. Indian Journal of Mycology & Plant Pathology， 1992： 142-145.
[5]ZHANG GY. Isolation screening and identification of antagonistic bacteria against Ustilago scitaminea sydow and studies on their antagonistic mechanisms[D]. Nanning： Guangxi University， 2002.
[6]XIONG GR， ZHAO GF， WU SR， et al. Screening and identification of a biocontrol strain， HAS antagonistic to Sporisorium scitaminea Syd[J]. Chinese Journal of Tropical Crops， 2013， 34（6）： 1149-1154.
[7]XIONG GR， WU SR， ZHANG SZ， et al. Bacillus subtilis HAS and its application in the control of sugarcane smut[P]. China： CN102899280A， 2013-01-30.
[8]XIONG GR， WU SR， ZHAO GF， et al. Cloning， expression and application of the coding gene of an antimicrobial protein HAS1[P]. China： CN103031309A， 2013-04-10.
[9]VALOIS D， FAYAD K， BARASUBIYE T， et al. Glucanolytic actinomycetes antagonistic to Phytophthora fragariae var. rubi， the causal agent of raspberry root rot[J]. Appl Environ Microbiol， 1996， 62（5）： 1630-1635.
[10]PATIL HJ， SRIVASTAVA AK， KUMAR S， et al. Selective isolation， evaluation and characterization of antagonistic actinomycetes against Rhizoctonia solani[J]. World Journal of Microbiology & Biotechnology， 2010， 26（12）：2163-2170.
[11]XIONG SJ， SUN CL， SHI C， et al. Screening and identifying of antagonistic actinomycetes against Ralstonia solancearum[J]. Northern Horticulture， 2014（5）： 114-117.
[12]LAI NN， ZHU WR， LIU Z， et al. Isolation and screening of antagonistic actinomycetes against Xinjiang cotton Verticillium wilt[J]. Jiangsu Agricultural Sciences， 2015， 43（1）： 119-121.
[13]FAN YH， WANG J. Screening， identification， and inhibitory effect of antagonistic actinomycetes against Macrophoma kuwatsukai causing winter jujube ring grain disease[J]. Biotechnology Bulletin， 2017， 33（7）： 114-119.
Editor： Yingzhi GUANG Proofreader： Xinxiu ZHU
[Methods]At first， actinomycetes strains were isolated from 22 soil samples in Hainan sugarcane regions. Then， antagonistic actinomycetes against U. scitaminea were screened by confrontation culture. Finally， the taxonomic status of antagonistic actinomycetes was determined using 16S rDNA.
[Results]From the 22 samples， 984 actinomycetes strains were isolated. From all the isolated strains， 23 antagonistic actinomycetes strains were obtained through primary screening， and one strains with better antagonistic effect was then obtained through secondary screening， and designated FAS. 16S rDNA identification showed that strain FAS shared 99% sequence similarity with Streptomyces cealestis US24. A phylogenetic tree was built with MAGE 7.0 software， and the results showed that strain FAS had the shortest genetic distance with S. caelestis US24. Therefore， the actinomycetes FAS was determined as S. caelestis.
[Conclusions]This study provides a new biocontrol method for the biological control of sugarcane smut， thereby ensuring sustainable development of sugarcane industry and sugar industry.
Key words Sugarcane smut； 16S rDNA identification； Streptomyces caelestis； Antagonistic effect
Sugarcane smut was found and reported for the first time in Natal， South Africa， in 1877[1]. It is caused by Ustilago scitaminea Syd.， which could disease sugarcane in sugarcane regions around the world， thereby seriously affecting the yield and quality of sugarcane[2]. In order to effectively control the occurrence of sugarcane smut， scholars have conducted studies on the biological control of sugarcane smut. At abroad， Sinha et al.[3]and Vaishnav et al.[4]studied the fungal antagonistic effect against sugarcane smut， and concluded that four fungi had the development potential of biological control. In China， Zhang et al. [5]studied the antagonistic bacteria against sugarcane smut in 2002， and Xiong et al.[6-7]studied the antagonistic bacteria HAS against sugarcane smut in 2013. Through pot experiments and field experiments， the efficacy was investigated， and the results showed that the antagonistic bacteria HAS had very good inhibiting effect on sugarcane smut. Furthermore， Xiong et al.[8]successfully isolated during studying the antibacterial mechanism of Bacillus subtilis HAS， a kind of new antibacterial protein， thereby providing an antigen material for the experimental research about transgenic sugarcane breeding. There have been many studies on the biocontrol of different pathogenic bacteria relating to antagonistic actinomycetes. Valois et al.[9]reported the antagonistic effect of actinomycetes on Xanthomonas fragariae in 1996. In 2010， Patil et al.[10]published their study about the antagonistic effect of antagonistic actinomycetes on Rhizoctonia solani， in which they successfully screened nine actinomycetes strains with better antagonism. Xiong et al.[11]conducted a study on the biocontrol of R. solanacearum using antagonistic actinomycetes in 2014. In 2015， Lai et al.[12]studied the antagonistic actinomycetes against Xinjiang cotton Verticillium wilt. Fan et al.[13]studied the antagonistic effect of antagonistic actinomycetes on Macrophoma kuwatsukai. The fermentation liquids of these antagonistic actinomycetes have remarkable inhibiting effect on pathogenic bacteria， with very good development potential for biocontrol.
In this study， actinomycetes strains were isolated from soil in sugarcane regions， and antagonistic actinomycetes against U. scitaminea was obtained through screening. The research results will provide a new biocontrol method for the biological control of sugarcane smut， thereby ensuring sustainable development of sugarcane industry and sugar industry.
Materials and Methods
Strains
The target strain， U. scitaminea Syd. was persevered in laboratory.
Sample acquisition
The rhizosphere soil of sugarcane was collected from the sugarcane regions in Hainan. All the collected samples were numbered， and the soil type， sampling location， sampling time and location information were recorded （Table 1）.
Methods
Isolation， purification and preservation of soil actinomycetes
According to references[9-13]， the collected soil samples were airdried and sieved with a 2 mm standard sieve. Then， 5 g of each sample was weighed and added into a 250 ml triangular flask filled with 1 00 ml of sterile water. The triangular flask was vibrated on a shaker for 30 min and stood for a period of time. From the triangular flask， 100 μl of the suspension was pipetted into a 2 ml centrifuge tube filled with 900 μl of sterile water， followed by mixing well. The diluted suspension was then diluted sequentially to 10-7. For each gradient dilution， 100 μl was pipetted and coated onto a GAUZE’s medium plate with a sterile coating rod， and three replicates were done. The plates were inverted and placed in an incubator at 28 ℃ for 5-7 d. For the various samples， isolation was performed， followed by counting. Meanwhile， through observation， actinomycetes strains， which differed in size， morphology and color， were picked and inoculated on new GAUZE’s medium plates， for purification and culture and preservation. Screening of antagonistic actinomycetes
Antagonistic strains were screened by point inoculation method. At first， 1 ml of the U. scitaminea suspension and improved PDA medium were mixed and uniformly added into a plate. After the medium was solidified， a purified actinomycetes strain was picked with a sterile toothpick and inoculated. The plate was inverted and placed in an incubator at 28 ℃. The inoculated strains were cultured for 3-7 d， and the experimental phenomena were observed and recorded.
16S rDNA identification of antagonistic actinomycetes FAS
According to references[9-13]， the genomic DNA of actinomycetes FAS was extracted， and amplification was performed using universal primers 27F： 5′AGAGTTTGATCCTGGCTCAG3′ and 1492R： 5′ACGGCTACCTTGTTACGACT3′. The amplification product was subjected to gel extraction， and the recovered product was ligated to vector pMD19T and transformed to Escherichia coli DH5α competent cells. Positive clones were subjected to PCR identification after selection and culture， and finally transported to Sangon Biotech （Shanghai） Co.， Ltd. for sequencing.
Analysis of sequencing results and Determination of taxonomic status of strain FAS
The sequences obtained after sequencing were aligned in NCBI after the removal of the vector sequence. Meanwhile， different strain information was selected， and a phylogenetic tree was constructed with MAGE7.0 software， to determine the taxonomic status of strain FAS.
Results and Analysis
Isolation， purification and preservation of actinomycetes in soil samples
The collected samples were subjected to serial dilution and plate isolation， and after counting and calculation， it could be known that the actinomycetes content in the soil of the sugarcane regions in Hainan was 3.7×104-4.8×106 cfu/g dry soil. The actinomycetes content was the lowest （3.7×104 cfu） in the sandy loam of Haiwei Town， Changjiang County， and the highest （4.8×106 cfu） in the sandy loam of Bohou Town， Lingao County. The actinomycetes was mostly 105 in different types of soils in various areas （Table 1）. According to colony size， morphology and color， 984 actinomycetes strains were purified and preserved.
Screening of antagonistic actinomycetes
With U. scitaminea as the target strain， antibacterial tests were conducted on the 984 actinomycetes strains by point inoculation method， and 23 actinomycetes strains having inhibiting effect on U. scitaminea were screened. Secondary screening was performed through confrontation culture tests， and an actinomycetes strain with better antagonistic effect on U. scitaminea was obtained （Fig. 1）. It had remarkable antibacterial effect， with an inhibitory zone diameter of 21 mm. This strain was designated FAS. 6S rDNA identification of strain FAS and determination of its taxonomic status
The genomic DNA of strain FAS was extracted， and amplification was performed using universal primers. After gel extraction， transformation and removal of vector， a 1 491 bp sequence was obtained. The sequence is given as below （Fig.2）
BLAST alignment in NCBI showed that the sequence shared 99% similarity with the sequence of Streptomyces caelestis， and the strain was preliminarily identified as S. caelestis. A phylogenetic tree was built with MAGE 7.0 software using 13 strains with following accession numbers： GU045531.1， LC128333.1， KX777603.1， KY628828.1， KF804152.1， GU045531.1， JQ358578.1， JX204833.1， FJ842610.1， JQ358565.1， AY875718.1， AM889494.1 and CP015849.1 （Fig. 3）. The results showed that strain FAS had the shortest genetic distance with S. caelestis US24. Therefore， the antagonistic actinomycetes FAS was determined as S. caelestis.
Conclusions and Discussion
In this study， rhizosphere soil was collected from the sugarcane fields in main sugarcane regions in Hainan Province， and an actinomycetes strain with better antagonistic effect was obtained through isolation and screening， and designated FAS. The strain was subjected to 16S rDNA identification and sequence alignment in NCBI. The alignment results showed that strain FAS shared 99% sequence similarity with S. cealestis US24. A phylogenetic tree was built with MAGE 7.0 software， and the results showed that strain FAS had the shortest genetic distance with S. caelestis US24. Therefore， the actinomycetes FAS was determined as S. caelestis.
In this study， the antagonistic actinomycetes FAS was only preliminarily identified as S. caelestis through 16S rDNA at molecular level， without doing any further physiological and biochemical experiments. The active components also need further study. However， the antagonistic actinomycetes FAS against U. scitaminea was successfully screened， which supports actinomycetes as the biocontrol strains for sugarcane smut. Actinomycetes FAS becomes a potential strain for the control of sugarcane smut.
References
[1]LU WJ， LI WF， HUANG YK. Research advances on sugarcane smut disease occurrence and control[J]. Sugar Crops of China， 2008， 2008（3）： 64-66.
[2]RILEY IT， JUBB TF， EGAN BT， et al. First outbreak of sugarcane smut in Australia[C]. Xxiii Issct Congress， New Delhi， India， 1999（2）： 22-26.
[3]SINHA OK， SINGH K. Antagonistic activity of Fusarium moniliforme var. sub. glutinans against sugarcane smut[J]. Indian Phytopathology， 1983： 92-94. [4]VAISHNAV MU， SABALPARA AN， KHANDAR RR. Mycoparasitism on sugarcane smut （Ustilago scitaminea Syd.） by four fungi[J]. Indian Journal of Mycology & Plant Pathology， 1992： 142-145.
[5]ZHANG GY. Isolation screening and identification of antagonistic bacteria against Ustilago scitaminea sydow and studies on their antagonistic mechanisms[D]. Nanning： Guangxi University， 2002.
[6]XIONG GR， ZHAO GF， WU SR， et al. Screening and identification of a biocontrol strain， HAS antagonistic to Sporisorium scitaminea Syd[J]. Chinese Journal of Tropical Crops， 2013， 34（6）： 1149-1154.
[7]XIONG GR， WU SR， ZHANG SZ， et al. Bacillus subtilis HAS and its application in the control of sugarcane smut[P]. China： CN102899280A， 2013-01-30.
[8]XIONG GR， WU SR， ZHAO GF， et al. Cloning， expression and application of the coding gene of an antimicrobial protein HAS1[P]. China： CN103031309A， 2013-04-10.
[9]VALOIS D， FAYAD K， BARASUBIYE T， et al. Glucanolytic actinomycetes antagonistic to Phytophthora fragariae var. rubi， the causal agent of raspberry root rot[J]. Appl Environ Microbiol， 1996， 62（5）： 1630-1635.
[10]PATIL HJ， SRIVASTAVA AK， KUMAR S， et al. Selective isolation， evaluation and characterization of antagonistic actinomycetes against Rhizoctonia solani[J]. World Journal of Microbiology & Biotechnology， 2010， 26（12）：2163-2170.
[11]XIONG SJ， SUN CL， SHI C， et al. Screening and identifying of antagonistic actinomycetes against Ralstonia solancearum[J]. Northern Horticulture， 2014（5）： 114-117.
[12]LAI NN， ZHU WR， LIU Z， et al. Isolation and screening of antagonistic actinomycetes against Xinjiang cotton Verticillium wilt[J]. Jiangsu Agricultural Sciences， 2015， 43（1）： 119-121.
[13]FAN YH， WANG J. Screening， identification， and inhibitory effect of antagonistic actinomycetes against Macrophoma kuwatsukai causing winter jujube ring grain disease[J]. Biotechnology Bulletin， 2017， 33（7）： 114-119.
Editor： Yingzhi GUANG Proofreader： Xinxiu ZHU