论文部分内容阅读
Abstract [Objectives] The study was conducted to investigate the molecular identification of Salvia miltiorrhiza Bge. and its adulterants by DNA barcoding andspecific primer PCR.
[Methods] With ITS2 sequenceas DNA barcode， the materials were amplified by PCR and sequenced， and the NJ phylogenetic tree was constructed. The secondary structure of ITS2 was predicted by database and its website established by Koetschan et al.， and the selfdesigned primers were used to carry out specific primer PCR identification.
[Results] ITS2 sequence length was around 470 bp. The results of cluster analysis showed that S. miltiorrhiza Bge. and its adulterants were clustered on different branches and showed monophyly. The comparison of secondary structure showed that S. miltiorrhiza Bge. had little differences from S. przewalskii， while there were significant differences from A. lappa in the number， size and location of stemloop and the rotation angle of the spiral arm from the central ring. The specific primers could distinguish the S. miltiorrhiza Bge. and its counterfeits by PCR technique.
[Conclusions] DNA barcoding and specific primer PCR are effective in distinguishing S. miltiorrhiza Bge. and its adulterants， and it has an important application foreground in the identification of Chinese herbal medicines.
Key words Salvia miltiorrhiza Bge.； DNA barcoding； Secondary structure； PCR technique
Received： November 7， 2017 Accepted： January 3， 2018
Ping ZHANG（1989-） ， female， P. R. China， master， devoted to research about identification and quality evaluation of traditional Chinese medicines.
*Corresponding author. Email： zhangping203@163.com.
Salvia miltiorrhiza Bge. is recorded in "Chinese Pharmacopoeia"（2015 edition） as the dry roots and rhizomes of S. miltiorrhiza Bge. in Lamiaceae family， which have the effects of invigorating the circulation of blood， inducing menstruation to relieve menalgia， and cooling blood to eliminate carbuncle[1]. However， the main producing areas of S. miltiorrhiza Bge. mainly concentrate in Rizhao of Shandong Province， Shangluo of Shaanxi Province， Zhongjiang of Sichuan Province and Neixiang of Henan Province. Most of the resources are cultivars， and the germplasm resources are preserved by domestication of wild varieties， seed propagation and vegetable propagation using roots[2]. S. miltiorrhiza Bge. serving as one of the top10 common medicinal materials in China， has been used in clinic for more than 2 000 years， and its demand is increasing year by year due to its pharmacological effects of preventing blood coagulation， promoting fibrinolysis， dilating blood vessels， improving microcirculation， scavenging free radicals and protecting mitochondria[3]. However， there are a great variety of traditional Chinese medicines， which are difficult to differentiate， and many merchants seize the chance to mix true materials and adulterants， to make money. Therefore， under the premise of ensuring material quality and clinical efficacy， it is urgent to construct to scientific， reliable and convenient identification method[4]. DNA barcode as a new development direction of molecular marker has been gradually used for the classification and identification of traditional Chinese medicine in recent years[5]. DNA sequence information could provide massive reliable information data for systematic research， and its analysis results could verify existing taxonomy results. DNA barcoding technology has the characteristics of strong specificity， little consumption of sample， high speed and high accuracy， and could identify traditional Chinese medicines at the molecular level[6-7]. Chen[5] put forward the identification system taking ITS2 sequence as the main sequence and psbAtrnH as the auxiliary sequence after more than 10 years of research. ITS2 sequence is the ribosome DNA sequence spacer region having 5.8S rRNA sequence and 28S rRNA sequence removed， and could be used for the identification of most herbal medicinal materials and their chaotic varieties[8-10]. In this study， DNA barcoding identification was performed on S. miltiorrhiza Bge. and its adulterants using ITS2 sequence， and the identification using specific primer PCR technique was also carried out， so as to provide experimental data for the research about the identification of the herbal material at molecular level.
Materials and Methods
Materials
Tested materials
The materials are shown in Table 1， including testing samples and sequences downloaded from Genbank.
Reagents
Plant DNA extraction kit， purchased from Aidlab Biotechnologies Co.，Ltd； agarose （Biowest），purchased from Qingdao Xiubairui Biological Devices and Materials Co.， Ltd.； Gene nucleic acid dye， 2* Taq PCR Mixture and Marker， purchased from Tiangen Biotech （Beijing） Co.， Ltd.； primers， synthesized by Sangon Biotech （Shanghai） Co.，Ltd.； other reagents， analytically pure.
Instruments
ProFlex type gradient PCR instrument （Applied BiosystemCompany）； THZ82 type doubledigital rotary water bath oscillator（Jintan Chengdong Xinrui Instrument Plant）； JS680D type gel imager（Shanghai Peiqing Science and Technology Co.， Ltd.）； MBE150 type electrophoresis apparatus（MS， America）； Micro 21R table type highspeed refrigerated centrifuge （Thermo， America）.
Table 1 Material sources
No.Latin name of material Specimen numberGenBankaccession number
D1 S. miltiorrhiza Bge.--
D2 S. miltiorrhiza Bge.--
D3S. miltiorrhiza Bge.160403117-
D4S. miltiorrhiza Bge.160401117-
D5 S. miltiorrhiza Bge.160401117- D6 S. miltiorrhiza Bge.160402117-
D7 S. miltiorrhiza Bge.160403117-
D8 S. miltiorrhiza Bge.160404117-
D9S. miltiorrhiza Bge.160405117-
D10S. miltiorrhiza Bge.--
D11S. miltiorrhiza Bge.120923-201113-
G1 S. przewalskii Maxim.--
G2 S. przewalskii-FJ883526. 1
G3 S. przewalskii-KC473272.1
N1 A. lappa--
N2 A. lappa-FJ440323.1
N3A. lappa-FJ528300.1
N4A. lappa-AF319102.1
Methods
DNA extraction
Samples were scrubbed with 70% ethanol and airdried. Each sample was ground in a freezing grinding instrument at 60 Hz for 90 s， for two times. Then 20 mg of each sample was weighed and subjected to extraction of total DNA with the new plant genomic DNA rapid extraction kit produced by Aidlab Biotechnologies Co.，Ltd. with small changes.
PCR amplification and sequencing
ITS2 universal primers were forward primer： 5ATGCGATACTTGGTGTGAAT3， and reverse primer： 5GACGCTTCTCCAGACTACAAT3； and the specific primers were forward primer： 5CGCATCGCGTCGCCCC3； and reverse primer： 5CGGTCGAAGGTTGGGCGCC3. The reaction system had a total volume of 25 μl， including 2*TaqPCR Mixture12.5 μl， DNA template 1.0 μl， ddH2O 9.5 μl， and 10 μmol/L forward primer and reverse primer， each 1.0 μl. The reaction was performed on the ProFlex type gradient PCR instrument. After amplification， 6 μl of the reaction solution was added into 2.0% agarose gel hole， and electrophoresis was performed under 120 V and 70 mA. The gene expression condition was detected with the gel imaging system， followed by photographing. Sequencing was performed with a first generation sequencer.
Data analysis
The sequenced peak shapes were checked with Chromas software， and the successful sequences were ligated with DNAman. For the ITS2 sequences in Genbank， ITS2 spacer region sequences were obtained， based on Hidden Markov Model （HMMer） annotation method of hidden Markov model. All the sequences were aligned using MEGA 5.0 software； and genetic distances were analyzed， a phylogenetic tree was built by neighborjoining （NJ） method， and the support rate of each branch was checked by Bootstrap 1 000 times. According to the ITS2 database constructed by Koetschan et al.[11] and the prediction function of the website，ITS2 secondary structures were predicted.
Results and Analysis
Sequence comparison and clustering analysis
The ITS2 sequences were all about 461 bp. In S. miltiorrhiza Bge. sequence， there were 5 variable sites， and 2 polymorphic sites， and the average proportion of G base and C base was 60.8%. According to the average intraspecific genetic distance （0.004） calculated by Kimura 2parametermodel， the smallest genetic distance was 0.000， which occurred between any two of D2， D4， D5， D6， D9 and D11， indicating that the 6 samples were the closest， and belonged to the same genus. Based on ITS2 sequences， it could be seen from the phylogenetic tree built by NJ method （Fig. 1） that S. miltiorrhiza Bge. and its adulterants S. przewalskii and A. lappa were clustered on different branches， exhibiting monophyly， and the support rates of branches were over 50%， so the three could be separated. Fig. 1 Adjacent（NJ） trees of S. miltiorrhiza Bge. and its adulterants based on ITS2 sequences
Secondary structures of ITS2 sequences of S. miltiorrhiza Bge. and its adulterants
Form the comparison of the secondary structures of S. miltiorrhiza Bge. and some of its adulterants （Fig. 2 ）， it could be seen that S. miltiorrhiza Bge. had little differences from S. przewalskii， and only two stemloops at the top of the III region differed slightly. The differences from A. lappa were greater， and there were differences in all the 4 regions， among which the II region differed little. Through the comparison of ITS2 secondary structures， S. miltiorrhiza Bge. could be separated from other adulterants.
Fig. 2 Comparison of ITS2 secondary structure of S. miltiorrhiza Bge. and its adulterants
Ping ZHANG et al. Molecular Identification of Salvia Miltiorrhiza Bge. and Its Adulterants Based on ITS2 Sequences
Identification of specific primers
It could be seen from PCR amplification （Fig. 3） that the target band was amplified from all the S. miltiorrhiza Bge. samples， while its adulterants S. przewalskii and A. lappa both could not produced the target band， and the negative control showed no bands. It indicates that S. miltiorrhiza Bge. and its adulterants could be separated by specific primer PCR technique.
M is the marker； D1D10 are the samples of S. miltiorrhiza Bge.； G1 is S. przewalskii； N1 is A. Lappa； D1 is the control herbs of S. miltiorrhiza Bge.； empty is blank control.
Fig. 3 Gel electrophoresis diagram of S. miltiorrhiza Bge. and its adulterants
Discussion
S. miltiorrhiza Bge. was firstly recorded in "The Holy Husbandmans Classic on Roots and Herbs". It has a long use history in China， and is also known as "Danshen" due to its red color and shape similar to ginseng. In recent years， with the reduction of wide resources of S. miltiorrhiza Bge.， the diversity of the genetic resources of cultivated S. miltiorrhiza Bge. has nondeterminancy， and many adulterants appeared in the market， such as Salvia plants including S. przewalskii Maxim.， S. trijuga Diels.， S. digitaloides Diels and S. yunnanensis C. H. Wright. Furthermore， market survey showed that some small retailers sell stained A. lappa as S. miltiorrhiza Bge. Therefore， potential safety hazard exists for the quality of S. miltiorrhiza Bge. In addition， there are also literatures reporting that the roots and rhizomes of more than 40 Salvia varieties were used as S. miltiorrhiza Bge.， and the study on the contents of chemical components showed that more than 30 varieties had the contents of fatsoluble components equivalent to S. miltiorrhiza Bge. And could be used as new resources of S. miltiorrhiza Bge.[12]. This study selected S. przewalskii and A. lappa as two adulterants which were compared with S. miltiorrhiza Bge.， and NJ clustering analysis showed that the 11 S. miltiorrhiza Bge. samples were clustered on the same branch， and then clustered with S. przewalskii into one branch， indicating that they were genetically closer， which could provide data support for the new resource viewpoint in previous studies； and A. lappa was clustered to one branch alone， and it could be seen from genetic diversity analysis that S. miltiorrhiza Bge. is genetically farther to A. lappa and these two are in different families. According to Chinese Pharmacopoei of the four general rules， the recommended main sequences of botanical drugs are universal primers ITS2F and ITS3R for ITS2 fragment， and the auxiliary sequences are universal primers psbAF and trnHR for amplificaiton of psbAtrnH fragment[13]. In this study， the universal main primers were selected at first， and the results showed that after PCR， S. miltiorrhiza Bge. and its adulterants both could be amplified successfully， and after sequencing， S. miltiorrhiza Bge. and its adulterants could be differentiated. Furthermore， identification was also performed by PCR technique. After the screening of ITS2 sequences and design of primers， a pair of specific primers were finally selected， and through the amplification using the specific primers， the successful rate was very high， and the bands were very clear and stable. It indicates that the method could identify S. miltiorrhiza Bge. and its adulterants. This study could provide a more simpler and faster identification method for S. miltiorrhiza Bge. Conclusions
In this study， the identification of S. miltiorrhiza Bge. was realized both through the application of DNA barcoding and specific primer PCR technique， and the analysis of secondary structures， building of NJ tree and PCR amplification using specific primers. The results showed that ITS2 sequence could effectively identify S. miltiorrhiza Bge. and its adulterants. This study will provide important reference for the control of S. miltiorrhiza Bge. materials from the source， and the rational development and utilization of S. miltiorrhiza Bge. resources.
References
[1] Chinese Pharmacopoeia Commission. Chinese Pharmacopeia： the first volume[M]. Beijing： China Medical Science Press， 2015： 76-77.
[2] SONG ZQ， WANG JH， CHEN WX， et al. Genetic diversity analysis of Salvia miltiorrhiza Bge from different habitats by ESTSSR markers[J]. Acta Agriculturae Nucleatae Sinica， 2014， 28（2）： 193-199.
[3] ZHAO XL. The research progress of Slavia miltiorrhiza Bunge[J]. Brand， 2015（6）： 301-302.
[4] TANG XQ， WANG KC， CHEN X， et al. AFLP analysis of different cultivars of Slavia miltiorrhiza Bge[J]. Chinese Journal of Pharmaceutical Biotechnology， 2006， 13（3） ： 182-186.
[5] CHEN SL. DNA barcode standard sequences of Traditional Chinese medicinal materials in Chinese Pharmacopeia[M]. Beijing： Science Press， 2015.
[6] ZHANG TT， JIN HZ， WANG HT. Application progress of molecular markers in germplasm resource research on Radix Salviae Miltorrhizae （Danshen）[J]. Chinese Agricultural Science Bulletin， 2015， 31（32）： 68-71.
[7] HUANG LQ， YUAN Y， YUAN QJ， et al. Key problems in development of molecular identification in traditional Chinese medicine[J].China Journal of Chinese Materia Medica， 2014， 39（19）： 3663-3667.
[8] ZHANG LF. Chen Shilin： Traditional Chinese medicinal materials take a deep breath with the help of DNA barcode[N]. Medicine Economic Reporter， 2014-12-24（010）.
[Methods] With ITS2 sequenceas DNA barcode， the materials were amplified by PCR and sequenced， and the NJ phylogenetic tree was constructed. The secondary structure of ITS2 was predicted by database and its website established by Koetschan et al.， and the selfdesigned primers were used to carry out specific primer PCR identification.
[Results] ITS2 sequence length was around 470 bp. The results of cluster analysis showed that S. miltiorrhiza Bge. and its adulterants were clustered on different branches and showed monophyly. The comparison of secondary structure showed that S. miltiorrhiza Bge. had little differences from S. przewalskii， while there were significant differences from A. lappa in the number， size and location of stemloop and the rotation angle of the spiral arm from the central ring. The specific primers could distinguish the S. miltiorrhiza Bge. and its counterfeits by PCR technique.
[Conclusions] DNA barcoding and specific primer PCR are effective in distinguishing S. miltiorrhiza Bge. and its adulterants， and it has an important application foreground in the identification of Chinese herbal medicines.
Key words Salvia miltiorrhiza Bge.； DNA barcoding； Secondary structure； PCR technique
Received： November 7， 2017 Accepted： January 3， 2018
Ping ZHANG（1989-） ， female， P. R. China， master， devoted to research about identification and quality evaluation of traditional Chinese medicines.
*Corresponding author. Email： zhangping203@163.com.
Salvia miltiorrhiza Bge. is recorded in "Chinese Pharmacopoeia"（2015 edition） as the dry roots and rhizomes of S. miltiorrhiza Bge. in Lamiaceae family， which have the effects of invigorating the circulation of blood， inducing menstruation to relieve menalgia， and cooling blood to eliminate carbuncle[1]. However， the main producing areas of S. miltiorrhiza Bge. mainly concentrate in Rizhao of Shandong Province， Shangluo of Shaanxi Province， Zhongjiang of Sichuan Province and Neixiang of Henan Province. Most of the resources are cultivars， and the germplasm resources are preserved by domestication of wild varieties， seed propagation and vegetable propagation using roots[2]. S. miltiorrhiza Bge. serving as one of the top10 common medicinal materials in China， has been used in clinic for more than 2 000 years， and its demand is increasing year by year due to its pharmacological effects of preventing blood coagulation， promoting fibrinolysis， dilating blood vessels， improving microcirculation， scavenging free radicals and protecting mitochondria[3]. However， there are a great variety of traditional Chinese medicines， which are difficult to differentiate， and many merchants seize the chance to mix true materials and adulterants， to make money. Therefore， under the premise of ensuring material quality and clinical efficacy， it is urgent to construct to scientific， reliable and convenient identification method[4]. DNA barcode as a new development direction of molecular marker has been gradually used for the classification and identification of traditional Chinese medicine in recent years[5]. DNA sequence information could provide massive reliable information data for systematic research， and its analysis results could verify existing taxonomy results. DNA barcoding technology has the characteristics of strong specificity， little consumption of sample， high speed and high accuracy， and could identify traditional Chinese medicines at the molecular level[6-7]. Chen[5] put forward the identification system taking ITS2 sequence as the main sequence and psbAtrnH as the auxiliary sequence after more than 10 years of research. ITS2 sequence is the ribosome DNA sequence spacer region having 5.8S rRNA sequence and 28S rRNA sequence removed， and could be used for the identification of most herbal medicinal materials and their chaotic varieties[8-10]. In this study， DNA barcoding identification was performed on S. miltiorrhiza Bge. and its adulterants using ITS2 sequence， and the identification using specific primer PCR technique was also carried out， so as to provide experimental data for the research about the identification of the herbal material at molecular level.
Materials and Methods
Materials
Tested materials
The materials are shown in Table 1， including testing samples and sequences downloaded from Genbank.
Reagents
Plant DNA extraction kit， purchased from Aidlab Biotechnologies Co.，Ltd； agarose （Biowest），purchased from Qingdao Xiubairui Biological Devices and Materials Co.， Ltd.； Gene nucleic acid dye， 2* Taq PCR Mixture and Marker， purchased from Tiangen Biotech （Beijing） Co.， Ltd.； primers， synthesized by Sangon Biotech （Shanghai） Co.，Ltd.； other reagents， analytically pure.
Instruments
ProFlex type gradient PCR instrument （Applied BiosystemCompany）； THZ82 type doubledigital rotary water bath oscillator（Jintan Chengdong Xinrui Instrument Plant）； JS680D type gel imager（Shanghai Peiqing Science and Technology Co.， Ltd.）； MBE150 type electrophoresis apparatus（MS， America）； Micro 21R table type highspeed refrigerated centrifuge （Thermo， America）.
Table 1 Material sources
No.Latin name of material Specimen numberGenBankaccession number
D1 S. miltiorrhiza Bge.--
D2 S. miltiorrhiza Bge.--
D3S. miltiorrhiza Bge.160403117-
D4S. miltiorrhiza Bge.160401117-
D5 S. miltiorrhiza Bge.160401117- D6 S. miltiorrhiza Bge.160402117-
D7 S. miltiorrhiza Bge.160403117-
D8 S. miltiorrhiza Bge.160404117-
D9S. miltiorrhiza Bge.160405117-
D10S. miltiorrhiza Bge.--
D11S. miltiorrhiza Bge.120923-201113-
G1 S. przewalskii Maxim.--
G2 S. przewalskii-FJ883526. 1
G3 S. przewalskii-KC473272.1
N1 A. lappa--
N2 A. lappa-FJ440323.1
N3A. lappa-FJ528300.1
N4A. lappa-AF319102.1
Methods
DNA extraction
Samples were scrubbed with 70% ethanol and airdried. Each sample was ground in a freezing grinding instrument at 60 Hz for 90 s， for two times. Then 20 mg of each sample was weighed and subjected to extraction of total DNA with the new plant genomic DNA rapid extraction kit produced by Aidlab Biotechnologies Co.，Ltd. with small changes.
PCR amplification and sequencing
ITS2 universal primers were forward primer： 5ATGCGATACTTGGTGTGAAT3， and reverse primer： 5GACGCTTCTCCAGACTACAAT3； and the specific primers were forward primer： 5CGCATCGCGTCGCCCC3； and reverse primer： 5CGGTCGAAGGTTGGGCGCC3. The reaction system had a total volume of 25 μl， including 2*TaqPCR Mixture12.5 μl， DNA template 1.0 μl， ddH2O 9.5 μl， and 10 μmol/L forward primer and reverse primer， each 1.0 μl. The reaction was performed on the ProFlex type gradient PCR instrument. After amplification， 6 μl of the reaction solution was added into 2.0% agarose gel hole， and electrophoresis was performed under 120 V and 70 mA. The gene expression condition was detected with the gel imaging system， followed by photographing. Sequencing was performed with a first generation sequencer.
Data analysis
The sequenced peak shapes were checked with Chromas software， and the successful sequences were ligated with DNAman. For the ITS2 sequences in Genbank， ITS2 spacer region sequences were obtained， based on Hidden Markov Model （HMMer） annotation method of hidden Markov model. All the sequences were aligned using MEGA 5.0 software； and genetic distances were analyzed， a phylogenetic tree was built by neighborjoining （NJ） method， and the support rate of each branch was checked by Bootstrap 1 000 times. According to the ITS2 database constructed by Koetschan et al.[11] and the prediction function of the website，ITS2 secondary structures were predicted.
Results and Analysis
Sequence comparison and clustering analysis
The ITS2 sequences were all about 461 bp. In S. miltiorrhiza Bge. sequence， there were 5 variable sites， and 2 polymorphic sites， and the average proportion of G base and C base was 60.8%. According to the average intraspecific genetic distance （0.004） calculated by Kimura 2parametermodel， the smallest genetic distance was 0.000， which occurred between any two of D2， D4， D5， D6， D9 and D11， indicating that the 6 samples were the closest， and belonged to the same genus. Based on ITS2 sequences， it could be seen from the phylogenetic tree built by NJ method （Fig. 1） that S. miltiorrhiza Bge. and its adulterants S. przewalskii and A. lappa were clustered on different branches， exhibiting monophyly， and the support rates of branches were over 50%， so the three could be separated. Fig. 1 Adjacent（NJ） trees of S. miltiorrhiza Bge. and its adulterants based on ITS2 sequences
Secondary structures of ITS2 sequences of S. miltiorrhiza Bge. and its adulterants
Form the comparison of the secondary structures of S. miltiorrhiza Bge. and some of its adulterants （Fig. 2 ）， it could be seen that S. miltiorrhiza Bge. had little differences from S. przewalskii， and only two stemloops at the top of the III region differed slightly. The differences from A. lappa were greater， and there were differences in all the 4 regions， among which the II region differed little. Through the comparison of ITS2 secondary structures， S. miltiorrhiza Bge. could be separated from other adulterants.
Fig. 2 Comparison of ITS2 secondary structure of S. miltiorrhiza Bge. and its adulterants
Ping ZHANG et al. Molecular Identification of Salvia Miltiorrhiza Bge. and Its Adulterants Based on ITS2 Sequences
Identification of specific primers
It could be seen from PCR amplification （Fig. 3） that the target band was amplified from all the S. miltiorrhiza Bge. samples， while its adulterants S. przewalskii and A. lappa both could not produced the target band， and the negative control showed no bands. It indicates that S. miltiorrhiza Bge. and its adulterants could be separated by specific primer PCR technique.
M is the marker； D1D10 are the samples of S. miltiorrhiza Bge.； G1 is S. przewalskii； N1 is A. Lappa； D1 is the control herbs of S. miltiorrhiza Bge.； empty is blank control.
Fig. 3 Gel electrophoresis diagram of S. miltiorrhiza Bge. and its adulterants
Discussion
S. miltiorrhiza Bge. was firstly recorded in "The Holy Husbandmans Classic on Roots and Herbs". It has a long use history in China， and is also known as "Danshen" due to its red color and shape similar to ginseng. In recent years， with the reduction of wide resources of S. miltiorrhiza Bge.， the diversity of the genetic resources of cultivated S. miltiorrhiza Bge. has nondeterminancy， and many adulterants appeared in the market， such as Salvia plants including S. przewalskii Maxim.， S. trijuga Diels.， S. digitaloides Diels and S. yunnanensis C. H. Wright. Furthermore， market survey showed that some small retailers sell stained A. lappa as S. miltiorrhiza Bge. Therefore， potential safety hazard exists for the quality of S. miltiorrhiza Bge. In addition， there are also literatures reporting that the roots and rhizomes of more than 40 Salvia varieties were used as S. miltiorrhiza Bge.， and the study on the contents of chemical components showed that more than 30 varieties had the contents of fatsoluble components equivalent to S. miltiorrhiza Bge. And could be used as new resources of S. miltiorrhiza Bge.[12]. This study selected S. przewalskii and A. lappa as two adulterants which were compared with S. miltiorrhiza Bge.， and NJ clustering analysis showed that the 11 S. miltiorrhiza Bge. samples were clustered on the same branch， and then clustered with S. przewalskii into one branch， indicating that they were genetically closer， which could provide data support for the new resource viewpoint in previous studies； and A. lappa was clustered to one branch alone， and it could be seen from genetic diversity analysis that S. miltiorrhiza Bge. is genetically farther to A. lappa and these two are in different families. According to Chinese Pharmacopoei of the four general rules， the recommended main sequences of botanical drugs are universal primers ITS2F and ITS3R for ITS2 fragment， and the auxiliary sequences are universal primers psbAF and trnHR for amplificaiton of psbAtrnH fragment[13]. In this study， the universal main primers were selected at first， and the results showed that after PCR， S. miltiorrhiza Bge. and its adulterants both could be amplified successfully， and after sequencing， S. miltiorrhiza Bge. and its adulterants could be differentiated. Furthermore， identification was also performed by PCR technique. After the screening of ITS2 sequences and design of primers， a pair of specific primers were finally selected， and through the amplification using the specific primers， the successful rate was very high， and the bands were very clear and stable. It indicates that the method could identify S. miltiorrhiza Bge. and its adulterants. This study could provide a more simpler and faster identification method for S. miltiorrhiza Bge. Conclusions
In this study， the identification of S. miltiorrhiza Bge. was realized both through the application of DNA barcoding and specific primer PCR technique， and the analysis of secondary structures， building of NJ tree and PCR amplification using specific primers. The results showed that ITS2 sequence could effectively identify S. miltiorrhiza Bge. and its adulterants. This study will provide important reference for the control of S. miltiorrhiza Bge. materials from the source， and the rational development and utilization of S. miltiorrhiza Bge. resources.
References
[1] Chinese Pharmacopoeia Commission. Chinese Pharmacopeia： the first volume[M]. Beijing： China Medical Science Press， 2015： 76-77.
[2] SONG ZQ， WANG JH， CHEN WX， et al. Genetic diversity analysis of Salvia miltiorrhiza Bge from different habitats by ESTSSR markers[J]. Acta Agriculturae Nucleatae Sinica， 2014， 28（2）： 193-199.
[3] ZHAO XL. The research progress of Slavia miltiorrhiza Bunge[J]. Brand， 2015（6）： 301-302.
[4] TANG XQ， WANG KC， CHEN X， et al. AFLP analysis of different cultivars of Slavia miltiorrhiza Bge[J]. Chinese Journal of Pharmaceutical Biotechnology， 2006， 13（3） ： 182-186.
[5] CHEN SL. DNA barcode standard sequences of Traditional Chinese medicinal materials in Chinese Pharmacopeia[M]. Beijing： Science Press， 2015.
[6] ZHANG TT， JIN HZ， WANG HT. Application progress of molecular markers in germplasm resource research on Radix Salviae Miltorrhizae （Danshen）[J]. Chinese Agricultural Science Bulletin， 2015， 31（32）： 68-71.
[7] HUANG LQ， YUAN Y， YUAN QJ， et al. Key problems in development of molecular identification in traditional Chinese medicine[J].China Journal of Chinese Materia Medica， 2014， 39（19）： 3663-3667.
[8] ZHANG LF. Chen Shilin： Traditional Chinese medicinal materials take a deep breath with the help of DNA barcode[N]. Medicine Economic Reporter， 2014-12-24（010）.