论文部分内容阅读
Abstract Different sterile cytoplasm types of nine cabbage cytoplasmic male sterile materials were identified by molecular marker in the study， in order to better use molecular marker to conduct the assisted breeding in the future. Genomic DNA was isolated from Chinese cabbage by CTAB method. The design of two pairs of specific primers was performed on conserved flanking region of orf138 gene in the GenBank. PCR was performed with genomic DNA of the nine Chinese cabbage materials. The bands were sequenced. The homologous comparison was conducted in NCBI， and finally， the type of sterile cytoplasm was determined. The results showed that the bands were amplified only in four Chinese cabbage male sterile materials with two pairs of specific primers PI/PII and PIII/PIV， while the other five materials did not obtain the relative bands. The result was consistent with the field sterility identification. And then four molecular markers of Chinese cabbage Ogura cytoplasmic male sterility （CMS） were obtained. After conducting a homologous comparative analysis with BLAST in GenBank， it was found that the homologous degree was 100% in specific segments of the three sterility materials （L1CI， L3CI and L3 F1） and Ogu orf138 gene （GenBank accession No.： HQ149728） of the reported broccoli Ogu CMS. The homologous degree of L1F1 was 99% with a variation point. The type of cytoplasmic male sterility of the other five materials needed further research. Four materials of the nine were identified as the radish cytoplasmic male sterility materials and four molecular markers were obtained.
Key words Chinese cabbage （Brassica campestris L.）； Ogura cytoplasm male sterile； Molecular marker； Germplasm identification
Chinese cabbage （Brassica campestris L. ssp. Chinensis） belongs to Brassica in Cruciferae， and is native to China[1]. It has a cultivation history of thousands of years. It is cultivated in various areas of China， and serves as one of the very important vegetables in daily life. The first generation of hybrid of Chinese cabbage has significant heterosis[2]， and the main materials for producing the first generation of hybrid are selfincompatible lines and male sterile lines[3-4]. The production of the first generation of hybrid using selfincompatible line has many disadvantages， such as very easy degeneration after multiple generations of continuous selfing， high cost for harvesting and large investment[4]， while the production of hybrid using sterile male line has advantages such as simple operation， low cost， high hybrid rate and high hybrid purity， and is a more ideal production method of the first generation of hybrid[5]. Related studies have been conducted on the breeding and application of Chinese cabbage cytoplasmic male sterile line. Li et al.[6]transformed Brassica napus cytoplasmic male sterile material into a Chinese cabbage cytoplasmic male sterile line， with the B. napus cytoplasmic male sterile material as the female parent and Chinese cabbage inbred fertile line as male parent. Ke et al.[7]bred Chinese cabbage pol cytoplasmic male sterile line CMS34117 with pol CMS B. napus as female parent and Chinese cabbage 34117 as male parent by continuous backcrossing. Chinese cabbage cytoplasmic male sterile sources are mainly from heterogeneous materials such as radish ogura and B. napus polima， and due to single germplasm and weak hereditary， they faces the danger of destructive diseases and pests， which is not beneficial to the production of the F1 hybrid of Chinese cabbage. Therefore， it is necessary to enhance the introduction and exploration of new sterile resources. Wang et al.[8]successfully transferred Chinese cabbage sterile line 12A and Chinese cabbage sterile lines Qing1A and Qing 2A with B. napus cytoplasmic male sterile line Shan 2A as sterile source. Liu et al.[9]bred stem mustard cytoplasmic Chinese cabbage male sterile line with tuber mustard cytoplasmic sterile line as female parent by distant hybridization and multigeneration backcrossing. Ogu CMS was bred from a sterile plant found in a field planted with a radish variety for reserving seeds for planting in 1968 by Ogura[10]. The plant had the male organ totally aborted with a sterility reaching 100%. It is one of the cytoplasmic sterile sources with the most thorough sterility found so far， and has very high research value[11-13]. However， the problems including yellowing at low temperature and small or nonobvious nectary were found when transforming it into Chinese cabbage， broccoli and cauliflower[14]. Scholars at home and abroad improved it by different approaches and methods[15-17]， and have bred improved sterile lines which were applied in Chinese cabbage[18]， but the degradation of nectary is still very obvious.
Different cytoplasmic male sterility has different mechanisms， which are reflected by different restoring and maintaining relationships in genetics and different sterile genes at molecular level[19]. Researches have shown that orf138， orf222， orf224 and orf263 and orf288 are cytoplasmic genes of Ogu type radish， Nap type B. napus， Pol type B. napus and leaf mustard cytoplasmic sterile types， respectively[20]. The methods for cytoplasmic male sterility identification include cytological markers， protein markers， isozymes and DNA molecular markers. Because DNA polymorphic molecular markers are more stable， PCR using specific primers has been generally used for identifying cytoplasmic types[21]. orf138 and orf224atp6 are master genes of ogu and pol sterile types， respectively， and are only expressed specifically in respective sterile types[22].
In this study， nine Chinese cabbage cytoplasmic male sterile materials were selected and subjected to molecular identification using specific primers of Ogura sterile cytoplasms， to determine their sterile type. This study will lay a foundation for further innovation of Chinese cabbage germplasm resources and breeding using male sterile materials.
Materials and Methods
Experimental materials
The experiment was completed in Diantai Central Lab of Yunnan Agricultural University in September 2016. Nine Chinese cabbage materials were sown on July 6， 2016 in seedling trays. The true leaf grew out in early August， and tender leaves were collected on September 1 for DNA extraction. The male sterile germplasm materials of Chinese cabbage， L1CI （bred by the research group of this study）， L1， L1F1， L21， L22， L23， L3CI， L3 and L3F1 were provided by the Cruciferae Research Group of Institute of Horticultural Plants， Yunnan Academy of Agricultural Sciences. Experimental methods
Extraction of Chinese cabbage DNA
With the leaves of the nine materials as study object， the genomic DNA was extracted by improved CTAB method[23]. The DNA was dissolved and diluted with 1×TE to 20 ng/μl and placed in a refrigerator at -20 ℃.
Designing of specific primers
According to reported orf138 gene sequence[21]and the research results of professor Zhang from Northwest Agriculture & Forestry University[24]， two pairs of specific primers were designed with DNAMAN software （PI/PII and PIII/PIV）. The sequence of PI was 5′ATGATTACCTTTTTCGAAAAATTGT 3′， and the reverse sequence of PII was 5′TTTATTTTCTCGGTCCATTTTC3′. The sequence of PIII was 5′TAGCGCTATCTTTCGGCCCT3′， and the sequence of PIV was 5′ACCCGAAGGTCCTGGTCTCT3′. The primers were synthesized by Kunming Shuoqing Biotechnology Co.， Ltd.
PCR amplification and product detection
PCR amplification was performed to the nine Chinese cabbage materials using the synthesized specific primers PI/PII and PIII/PIV. The PCR reaction system was 25.0 μl， and the components are shown in Table 1. From the PCR reaction liquid， 6 ul was taken out and added with nucleic acid dye with volume 1/3 of the used reaction liquid. Electrophoresis detection was performed on 1% agarose gel， and observation and photographing were performed on an gel imaging system.
Recovery and sequencing of PCR product
The target fragment was recovered with the kit purchased from Kunming Shuoqing Biotechnology Co.， Ltd.， and transported to this company for sequencing. The obtained sequencing results were subjected to alignment and sequence analysis on NCBI.
Bioinformatics analysis of sequences
The obtained gene sequences were subjected to alignment in ClustalX2 software， and corrected artificially. Sequence analysis was performed on NCBI， and partial orf138 gene sequences in the database were subjected to similarity analysis with DNAMAN.
Results and Analysis
Detection of total DNA of nine Chinese cabbage materials
The nine sterile germplasm materials of Chinese cabbage， L1CI， L1， L1F1， L21， L22， L23， L3CI， L3 and L3F1 were subjected to extraction of total DNA by improved CTAB method. The results of 1% agarose gel electrophoresis showed that the extracted DNA had good quality （Fig. 1）. The total DNA was detected with a spectrophotometer， and the results showed that the A260/A280 values were in the range of 1.70-1.78. The final concentrations of the mother solutions were in the range of 16.35-17.50 μg/ml. It indicated that the extracted DNA could satisfy the requirements by subsequent experiment. PCR reaction and electrophoresis
The DNA of the nine Chinese cabbage germplasm materials was amplified using the designed primers PI/PII and PIII/PIV. The results of 1.0% agarose gel electrophoresis showed that with the genomic DNA of L1CI， L1F1， L3CI and L3F1 as templates， whether for using PI/PII as primers or using PIII/PIV as primers， bands could be obtained， but differed in size. The bands obtained using PI/PII as primers were about 0.4 kb， while those obtained with PIII/PIV as primers were about 1.0 kb （Fig. 2）. The sizes of the four obtained bands of L1CI， L1F1， L3CI and L3F1 were basically accordant with the molecular markers of Ogura cytoplasmic male sterility （CMS） containing orf138 gene fragment predicted in GenBank. However， with the DNA of L1， L21， L22， L23 and L3 as templates， obvious bright bands were all obtained by amplification.
Agricultural Biotechnology2018
Acquisition and sequencing of molecular markers of Chinese cabbage Ogura CMS
Analysis of PI/PII sequences
The sequencing results of fragments recovered after amplification using PI/PII were analyzed with ClustalX2 software， and the sequences were artificially corrected， obtaining the sequence at 305 bp （Fig. 3.）. However， the termination codon of the obtained sequence was not obtained. The sequencing result was subjected to homologous alignment in NCBI， and aligned with the orf138 gene of broccoli （the Genbank accession number： HQ149728）. The results showed that the gene of sample L1CI shared 100% homology with the orf138 gene of broccoli， and the gene of sample L1F1 shared 99% homology with the orf138 gene of broccoli. The sequences of samples L1CI， L3CI and L3F1 were completely the same. The No. 268 amino acid of sample L1F1 had one mutation site， and the G base was changed into A base （Fig. 4）.
Analysis of PIII/PIV sequences
The sequence amplified using PIII/PIV was cut， obtaining the sequence of 1 198 bp， which was designated as kzch1198. The sequences of L1CI， L1F1， L3CI and L3F1 were completely the same. The sequence was subjected to homology alignment in NCBI with Blastn online program. The results showed that it shared 99% homology with Raphanus sativus （the GenBank accession number： AB694744）， and the E value was 0. The fragment contained orf138 gene， which is the key factor determining Ogura CMS. Therefore， the obtained specific amplification band is the molecular marker of Ogura CMS （Fig. 5）.
Above research showed that the obtained kzch1198 is the molecular marker of Chinese cabbage Ogura CMS. Four of the nine materials （L1CI， L1F1， L3CI and L3F1） are Ogura CMS sources， and other five are not Ogura CMS sources. kzch1198 could be used for preliminary identification of Chinese cabbage Ogura CMS. Conclusions
In this study， the sterile cytoplasm types of nine Chinese cabbage materials were identified by molecular markers， and PCR amplification was performed using two pairs of specific primers PI/PII and PIII/PIV. Four Chinese cabbage materials of them （L1CI， L3CI， L3F1 and L1F1） gave bands， obtaining four molecular markers of Chinese cabbage Ogura CMS. Homologous alignment was performed with BLAST in GenBank， and it was found that the specific fragments of the three sterile materials L1CI， L3CI and L3F1 shared 100% homology with the Ogu orf138 gene of broccoli Ogu CMS （Genbank accession number： HQ149728）， and the specific fragment of L1F1 shared 99% homology with the Ogu orf138 gene of broccoli Ogu CMS， indicating that the four materials belongs to Ogura CMS sources， other five materials are not Ogura CMS sources， and their cytoplasmic male sterile types still need further study. The research results lay a foundation for further innovation of Chinese cabbage germplasm resources and breeding using male sterile materials， and also provides a simple method for rapid identification of Chinese cabbage cytoplasmic sterile types.
Discussion
Ogura sterility is caused by mitochondrial gene orf138[25-26]， which encodes a mitochondrial membrane protein of about 16 kD[23]. In the presence of restoration gene， the restoration gene regulates it and restores its fertility[27]. The genetic variation level of Cruciferae mitochondria is lower[28]， and the coding region of orf138 is a more conservative region in mitochondria. According to known molecular markers of cytoplasmic male sterility， nine materials were subjected to identification of cytoplasmic male sterility， and the results showed that four materials （L1CI， L3CI， L3F1 and L1F1） are Ogura cytoplasmic male sterile materials. It was found by sequencing and alignment that the four materials had no differences in gene coding region， which accords with the conclusion of Wang et al.[19]. However， the alignment with the gene sequences listed in NCBI database showed that the No. 268 amino acid of material L1F1 had had one mutation site， and the G base was changed into A base， but the variation locus did not change the phenotypic character of male sterility of the material and did not affect the experiment results.
In this study， four molecular markers related to Chinese cabbage Ogura CMS were obtained. This study provides a rapid method for molecular identification of Chinese cabbage Ogura CMS， and transforming Ogura into Chinese cabbage could lay a foundation for the molecular markerassisted breed of sterile genes， so as to greatly shorten the breeding time of sterile gene transformation. Four Ogura cytoplasmic sterile materials were identified from nine materials， and the cytoplasmic sterile types of other five materials still need further study. References
[1]LU YH. Monograph of olericulture[M]. Beijing： Chinas agriculture， 2000： 175. （in Chinese）
[2]ZHANG DS， XU JB， CAO MQ， et al. Study of new type cytoplasmic male sterile on chinese cabbage transferred from CMS 96[J]. Acta Agriculturae BorealiSinica， 2002， 17（1）： 60-63. （in Chinese）
[3]LIU YM， FANG ZY， SUN PT， et al. The main obtaining ways and application of the male sterility in cruciferae crops[J]. China Vegetables， 2002（2）： 52-55. （in Chinese）
[4]SHI Z， FANG ZJ， XU YJ， et al. Characterization of the Chinese cabbage hau cytoplasmic malesterile line and sequence analysis of the fertilityrelated gene[J]. Acta Horticulturae Sinica， 2012， 39（3）： 469-476. （in Chinese）
[5]ZHANG L， YASUMOTO K， YAMAGISHI H. Identification of cytoplasmic male sterility in Chinese radish following PCR analysis of mitochondrial DNA[J]. Plant Mol Biol Rep， 2012， 30： 817-825.
[6]LI QT， MENG PH， WU YY. Breeding of Chinese cabbage cytoplasmic male sterile line[J]. Guizhou Agricultural Sciences， 1995（3）： 1-4. （in Chinese）
[7]HE GL， ZHAO ZY， SONG YZ， et al. Breeding and application of Chinese cabbage heterogeneous cytoplasmic male sterile line CMS34117[J]. Acta Horticulturae Sinica， 1992， 19（4）： 333-340. （in Chinese）
[8]WANG XF， ZHANG YF， LI DR， et al. Selection of allogenic CMS and its good combinations of nonheading Chinese cabbage[J]. Journal of Anhui Agricultural Sciences， 2004， 32（1）： 87-88. （in Chinese）
[9]LIU HJ， WANG H. Breeding of allocytoplasmic male sterile line in autotetraploid Chinese cabbage pakchoi[J]. Journal of Nanjing Agricultural University， 2004， 27（23）： 30-33. （in Chinese）
[10]OGURA H， Studies on the new malesterility in Japanese radish with special reference to the utilization of this sterility towards the practical raising of hybrid seeds [J]. Memoirs of the Faculty of Agriculture， 1968， 6（2）： 39-78.
[11]JOU XL， CAO SC， WU ZX. Several main cytoplasmic male sterile type of Cruciferae crops and their utilization （first）[J]. Journal of Changjiang Vegetables， 1999（5）： 1-3. （in Chinese）
[12]LI GH， ZHANG YR， CAO J， et al. Application of heterosis of male sterility on cruciferous vegetable[J]. Acta Agriculturae Universitis Jiangxiensis， 2003， 25（2）： 181-186. （in Chinese）
[13]ZHANG ML， ZHANG XY， LI BG. The research progress on cytoplasmic malesterility system（CMS） in rapeseed in the world[J]. Heilongjiang Agricultural Sciences， 2004（1）： 36-38. （in Chinese） [14]WILLIAMS PH， HEYN FW. The origin and development of cytoplasmic male sterile Chinese cabbage[A]. Chinese Cabbage， Proceeding of the first international symposium[C]. Taiwan： Asian Vegetable Research and Development Center， 1981： 293-300.
[15]ROBERTSON D， EARLE JDP， MUTSCHLER MA. Analysis of organelle genomes in a somatic hybrid derived from cytoplasmic malesterile Brassica oleracea and atrazineresistant B. campestris [J]. Theoretical and Applied Genetics， 1987， 74（3）： 303-309.
[16]ZHU YY， YAO WY， ZHANG SQ， et al. Breeding and utilization of Brassica oleracea Ogura cytoplasmic male sterility line[J]. Acta Agriculturae Shanghai， 1988， 14（2）： 19-24. （in Chinese）
[17]FU TD， YANG GS， YANG XN， et al. Discovery， research and utilization of Brassica napus polima cytoplasmic male sterility[J]. Progress in Natural Science： National key laboratory communication， 1995， 5（3）： 287-293. （in Chinese）
[18]ZHANG DQ， ZHANG FL， XU JB. Characteristics of Chinese Cabbage Cytoplasmic Male Sterile CMS96[J]. Acta Agriculturae BorealiSinica， 2005， 20（1）： 59-62. （in Chinese）
[19]WANG GF， ZHANG LG， LI DX. Restoring and maintaining relationship and molecular identification of cytoplasmic male sterility in Chinese cabbage[J]. Journal of Northwest A & F University： Natural Science Edition， 2014， 42（7）： 183-190. （in Chinese）
[20]JI LZ， SUN DL， SUN LQ. Types and mechanisms of Cruciferae cytoplasmic male sterility[J]. Jiangsu Agricultural Sciences， 2007（3）： 106-110. （in Chinese）
[21]BONHOMME S， BUDAR F， LANCELIN D， et al. Sequence and transcript analysis of the Nco 2.5 Oguraspecific fragment correlation with cytoplasmic male sterility in Brassica hybrids[J]. Mol Gen Genet， 1992， 235： 340-348.
[22]LIU ZY， PETER SO， LONG MH， et al. A PCR assay for rapid discrimination of sterile cytoplasm types in maize[J]. Crop Science， 2002， 42： 566-569.
[23]JING ZG， PEI XL， TANG Z， et al. Molecular identification of Ogu cytoplasmic male sterile and sequence analysis in broccoli （Brassica oleracea var.italica）[J]. Guihaia，2015（02）：231-235-294. （in Chinese）
[24]XU XY， SUN XL， FANG ZY， et al. Clone and analysis of CMS related gene of heading Chinese cabbage [J]. Journal of Northwest A & F University： Natural Science Edition， 2014（12）： 119-125. （in Chinese）
[25]KRISHNASAMY S， MAKAROFF CA. Characterization of the radish mitochondrial orfB locus possible relationship with male sterility in Ogura radish[J]. Curr Genet， 1993， 24（1-2）： 156-163.
[26]YAMAGISHI H， TERACHI T. Intra and interspecific variations in the mitochondrial gene orf138 of Oguratype malesterile cytoplasm from Raphanus sativus and R. raphanistrum[J]. Theor Appl Genet， 2001， 103（5）： 725-732.
[27]GRELON M， BUDAR F， BONHOMME S， et al. Ogura cytoplasmic malesterility （CMS）associated orf138 is translated into a mitochondrial membrane polypeptide in malesterile Brassica cybrids[J]. Mol Gen Genet， 1994， 243（5）： 540-547.
[28]HIESEL R， HAESELER AV， BRENNICKE A. Plant mitochondrial nucleic acid sequences as a tool for phylogenetic analysis[J]. Proc Natl Acad Sci， 1994， 91（2）： 634-638.
Editor： Yingzhi GUANG Proofreader： Xinxiu ZHU
Key words Chinese cabbage （Brassica campestris L.）； Ogura cytoplasm male sterile； Molecular marker； Germplasm identification
Chinese cabbage （Brassica campestris L. ssp. Chinensis） belongs to Brassica in Cruciferae， and is native to China[1]. It has a cultivation history of thousands of years. It is cultivated in various areas of China， and serves as one of the very important vegetables in daily life. The first generation of hybrid of Chinese cabbage has significant heterosis[2]， and the main materials for producing the first generation of hybrid are selfincompatible lines and male sterile lines[3-4]. The production of the first generation of hybrid using selfincompatible line has many disadvantages， such as very easy degeneration after multiple generations of continuous selfing， high cost for harvesting and large investment[4]， while the production of hybrid using sterile male line has advantages such as simple operation， low cost， high hybrid rate and high hybrid purity， and is a more ideal production method of the first generation of hybrid[5]. Related studies have been conducted on the breeding and application of Chinese cabbage cytoplasmic male sterile line. Li et al.[6]transformed Brassica napus cytoplasmic male sterile material into a Chinese cabbage cytoplasmic male sterile line， with the B. napus cytoplasmic male sterile material as the female parent and Chinese cabbage inbred fertile line as male parent. Ke et al.[7]bred Chinese cabbage pol cytoplasmic male sterile line CMS34117 with pol CMS B. napus as female parent and Chinese cabbage 34117 as male parent by continuous backcrossing. Chinese cabbage cytoplasmic male sterile sources are mainly from heterogeneous materials such as radish ogura and B. napus polima， and due to single germplasm and weak hereditary， they faces the danger of destructive diseases and pests， which is not beneficial to the production of the F1 hybrid of Chinese cabbage. Therefore， it is necessary to enhance the introduction and exploration of new sterile resources. Wang et al.[8]successfully transferred Chinese cabbage sterile line 12A and Chinese cabbage sterile lines Qing1A and Qing 2A with B. napus cytoplasmic male sterile line Shan 2A as sterile source. Liu et al.[9]bred stem mustard cytoplasmic Chinese cabbage male sterile line with tuber mustard cytoplasmic sterile line as female parent by distant hybridization and multigeneration backcrossing. Ogu CMS was bred from a sterile plant found in a field planted with a radish variety for reserving seeds for planting in 1968 by Ogura[10]. The plant had the male organ totally aborted with a sterility reaching 100%. It is one of the cytoplasmic sterile sources with the most thorough sterility found so far， and has very high research value[11-13]. However， the problems including yellowing at low temperature and small or nonobvious nectary were found when transforming it into Chinese cabbage， broccoli and cauliflower[14]. Scholars at home and abroad improved it by different approaches and methods[15-17]， and have bred improved sterile lines which were applied in Chinese cabbage[18]， but the degradation of nectary is still very obvious.
Different cytoplasmic male sterility has different mechanisms， which are reflected by different restoring and maintaining relationships in genetics and different sterile genes at molecular level[19]. Researches have shown that orf138， orf222， orf224 and orf263 and orf288 are cytoplasmic genes of Ogu type radish， Nap type B. napus， Pol type B. napus and leaf mustard cytoplasmic sterile types， respectively[20]. The methods for cytoplasmic male sterility identification include cytological markers， protein markers， isozymes and DNA molecular markers. Because DNA polymorphic molecular markers are more stable， PCR using specific primers has been generally used for identifying cytoplasmic types[21]. orf138 and orf224atp6 are master genes of ogu and pol sterile types， respectively， and are only expressed specifically in respective sterile types[22].
In this study， nine Chinese cabbage cytoplasmic male sterile materials were selected and subjected to molecular identification using specific primers of Ogura sterile cytoplasms， to determine their sterile type. This study will lay a foundation for further innovation of Chinese cabbage germplasm resources and breeding using male sterile materials.
Materials and Methods
Experimental materials
The experiment was completed in Diantai Central Lab of Yunnan Agricultural University in September 2016. Nine Chinese cabbage materials were sown on July 6， 2016 in seedling trays. The true leaf grew out in early August， and tender leaves were collected on September 1 for DNA extraction. The male sterile germplasm materials of Chinese cabbage， L1CI （bred by the research group of this study）， L1， L1F1， L21， L22， L23， L3CI， L3 and L3F1 were provided by the Cruciferae Research Group of Institute of Horticultural Plants， Yunnan Academy of Agricultural Sciences. Experimental methods
Extraction of Chinese cabbage DNA
With the leaves of the nine materials as study object， the genomic DNA was extracted by improved CTAB method[23]. The DNA was dissolved and diluted with 1×TE to 20 ng/μl and placed in a refrigerator at -20 ℃.
Designing of specific primers
According to reported orf138 gene sequence[21]and the research results of professor Zhang from Northwest Agriculture & Forestry University[24]， two pairs of specific primers were designed with DNAMAN software （PI/PII and PIII/PIV）. The sequence of PI was 5′ATGATTACCTTTTTCGAAAAATTGT 3′， and the reverse sequence of PII was 5′TTTATTTTCTCGGTCCATTTTC3′. The sequence of PIII was 5′TAGCGCTATCTTTCGGCCCT3′， and the sequence of PIV was 5′ACCCGAAGGTCCTGGTCTCT3′. The primers were synthesized by Kunming Shuoqing Biotechnology Co.， Ltd.
PCR amplification and product detection
PCR amplification was performed to the nine Chinese cabbage materials using the synthesized specific primers PI/PII and PIII/PIV. The PCR reaction system was 25.0 μl， and the components are shown in Table 1. From the PCR reaction liquid， 6 ul was taken out and added with nucleic acid dye with volume 1/3 of the used reaction liquid. Electrophoresis detection was performed on 1% agarose gel， and observation and photographing were performed on an gel imaging system.
Recovery and sequencing of PCR product
The target fragment was recovered with the kit purchased from Kunming Shuoqing Biotechnology Co.， Ltd.， and transported to this company for sequencing. The obtained sequencing results were subjected to alignment and sequence analysis on NCBI.
Bioinformatics analysis of sequences
The obtained gene sequences were subjected to alignment in ClustalX2 software， and corrected artificially. Sequence analysis was performed on NCBI， and partial orf138 gene sequences in the database were subjected to similarity analysis with DNAMAN.
Results and Analysis
Detection of total DNA of nine Chinese cabbage materials
The nine sterile germplasm materials of Chinese cabbage， L1CI， L1， L1F1， L21， L22， L23， L3CI， L3 and L3F1 were subjected to extraction of total DNA by improved CTAB method. The results of 1% agarose gel electrophoresis showed that the extracted DNA had good quality （Fig. 1）. The total DNA was detected with a spectrophotometer， and the results showed that the A260/A280 values were in the range of 1.70-1.78. The final concentrations of the mother solutions were in the range of 16.35-17.50 μg/ml. It indicated that the extracted DNA could satisfy the requirements by subsequent experiment. PCR reaction and electrophoresis
The DNA of the nine Chinese cabbage germplasm materials was amplified using the designed primers PI/PII and PIII/PIV. The results of 1.0% agarose gel electrophoresis showed that with the genomic DNA of L1CI， L1F1， L3CI and L3F1 as templates， whether for using PI/PII as primers or using PIII/PIV as primers， bands could be obtained， but differed in size. The bands obtained using PI/PII as primers were about 0.4 kb， while those obtained with PIII/PIV as primers were about 1.0 kb （Fig. 2）. The sizes of the four obtained bands of L1CI， L1F1， L3CI and L3F1 were basically accordant with the molecular markers of Ogura cytoplasmic male sterility （CMS） containing orf138 gene fragment predicted in GenBank. However， with the DNA of L1， L21， L22， L23 and L3 as templates， obvious bright bands were all obtained by amplification.
Agricultural Biotechnology2018
Acquisition and sequencing of molecular markers of Chinese cabbage Ogura CMS
Analysis of PI/PII sequences
The sequencing results of fragments recovered after amplification using PI/PII were analyzed with ClustalX2 software， and the sequences were artificially corrected， obtaining the sequence at 305 bp （Fig. 3.）. However， the termination codon of the obtained sequence was not obtained. The sequencing result was subjected to homologous alignment in NCBI， and aligned with the orf138 gene of broccoli （the Genbank accession number： HQ149728）. The results showed that the gene of sample L1CI shared 100% homology with the orf138 gene of broccoli， and the gene of sample L1F1 shared 99% homology with the orf138 gene of broccoli. The sequences of samples L1CI， L3CI and L3F1 were completely the same. The No. 268 amino acid of sample L1F1 had one mutation site， and the G base was changed into A base （Fig. 4）.
Analysis of PIII/PIV sequences
The sequence amplified using PIII/PIV was cut， obtaining the sequence of 1 198 bp， which was designated as kzch1198. The sequences of L1CI， L1F1， L3CI and L3F1 were completely the same. The sequence was subjected to homology alignment in NCBI with Blastn online program. The results showed that it shared 99% homology with Raphanus sativus （the GenBank accession number： AB694744）， and the E value was 0. The fragment contained orf138 gene， which is the key factor determining Ogura CMS. Therefore， the obtained specific amplification band is the molecular marker of Ogura CMS （Fig. 5）.
Above research showed that the obtained kzch1198 is the molecular marker of Chinese cabbage Ogura CMS. Four of the nine materials （L1CI， L1F1， L3CI and L3F1） are Ogura CMS sources， and other five are not Ogura CMS sources. kzch1198 could be used for preliminary identification of Chinese cabbage Ogura CMS. Conclusions
In this study， the sterile cytoplasm types of nine Chinese cabbage materials were identified by molecular markers， and PCR amplification was performed using two pairs of specific primers PI/PII and PIII/PIV. Four Chinese cabbage materials of them （L1CI， L3CI， L3F1 and L1F1） gave bands， obtaining four molecular markers of Chinese cabbage Ogura CMS. Homologous alignment was performed with BLAST in GenBank， and it was found that the specific fragments of the three sterile materials L1CI， L3CI and L3F1 shared 100% homology with the Ogu orf138 gene of broccoli Ogu CMS （Genbank accession number： HQ149728）， and the specific fragment of L1F1 shared 99% homology with the Ogu orf138 gene of broccoli Ogu CMS， indicating that the four materials belongs to Ogura CMS sources， other five materials are not Ogura CMS sources， and their cytoplasmic male sterile types still need further study. The research results lay a foundation for further innovation of Chinese cabbage germplasm resources and breeding using male sterile materials， and also provides a simple method for rapid identification of Chinese cabbage cytoplasmic sterile types.
Discussion
Ogura sterility is caused by mitochondrial gene orf138[25-26]， which encodes a mitochondrial membrane protein of about 16 kD[23]. In the presence of restoration gene， the restoration gene regulates it and restores its fertility[27]. The genetic variation level of Cruciferae mitochondria is lower[28]， and the coding region of orf138 is a more conservative region in mitochondria. According to known molecular markers of cytoplasmic male sterility， nine materials were subjected to identification of cytoplasmic male sterility， and the results showed that four materials （L1CI， L3CI， L3F1 and L1F1） are Ogura cytoplasmic male sterile materials. It was found by sequencing and alignment that the four materials had no differences in gene coding region， which accords with the conclusion of Wang et al.[19]. However， the alignment with the gene sequences listed in NCBI database showed that the No. 268 amino acid of material L1F1 had had one mutation site， and the G base was changed into A base， but the variation locus did not change the phenotypic character of male sterility of the material and did not affect the experiment results.
In this study， four molecular markers related to Chinese cabbage Ogura CMS were obtained. This study provides a rapid method for molecular identification of Chinese cabbage Ogura CMS， and transforming Ogura into Chinese cabbage could lay a foundation for the molecular markerassisted breed of sterile genes， so as to greatly shorten the breeding time of sterile gene transformation. Four Ogura cytoplasmic sterile materials were identified from nine materials， and the cytoplasmic sterile types of other five materials still need further study. References
[1]LU YH. Monograph of olericulture[M]. Beijing： Chinas agriculture， 2000： 175. （in Chinese）
[2]ZHANG DS， XU JB， CAO MQ， et al. Study of new type cytoplasmic male sterile on chinese cabbage transferred from CMS 96[J]. Acta Agriculturae BorealiSinica， 2002， 17（1）： 60-63. （in Chinese）
[3]LIU YM， FANG ZY， SUN PT， et al. The main obtaining ways and application of the male sterility in cruciferae crops[J]. China Vegetables， 2002（2）： 52-55. （in Chinese）
[4]SHI Z， FANG ZJ， XU YJ， et al. Characterization of the Chinese cabbage hau cytoplasmic malesterile line and sequence analysis of the fertilityrelated gene[J]. Acta Horticulturae Sinica， 2012， 39（3）： 469-476. （in Chinese）
[5]ZHANG L， YASUMOTO K， YAMAGISHI H. Identification of cytoplasmic male sterility in Chinese radish following PCR analysis of mitochondrial DNA[J]. Plant Mol Biol Rep， 2012， 30： 817-825.
[6]LI QT， MENG PH， WU YY. Breeding of Chinese cabbage cytoplasmic male sterile line[J]. Guizhou Agricultural Sciences， 1995（3）： 1-4. （in Chinese）
[7]HE GL， ZHAO ZY， SONG YZ， et al. Breeding and application of Chinese cabbage heterogeneous cytoplasmic male sterile line CMS34117[J]. Acta Horticulturae Sinica， 1992， 19（4）： 333-340. （in Chinese）
[8]WANG XF， ZHANG YF， LI DR， et al. Selection of allogenic CMS and its good combinations of nonheading Chinese cabbage[J]. Journal of Anhui Agricultural Sciences， 2004， 32（1）： 87-88. （in Chinese）
[9]LIU HJ， WANG H. Breeding of allocytoplasmic male sterile line in autotetraploid Chinese cabbage pakchoi[J]. Journal of Nanjing Agricultural University， 2004， 27（23）： 30-33. （in Chinese）
[10]OGURA H， Studies on the new malesterility in Japanese radish with special reference to the utilization of this sterility towards the practical raising of hybrid seeds [J]. Memoirs of the Faculty of Agriculture， 1968， 6（2）： 39-78.
[11]JOU XL， CAO SC， WU ZX. Several main cytoplasmic male sterile type of Cruciferae crops and their utilization （first）[J]. Journal of Changjiang Vegetables， 1999（5）： 1-3. （in Chinese）
[12]LI GH， ZHANG YR， CAO J， et al. Application of heterosis of male sterility on cruciferous vegetable[J]. Acta Agriculturae Universitis Jiangxiensis， 2003， 25（2）： 181-186. （in Chinese）
[13]ZHANG ML， ZHANG XY， LI BG. The research progress on cytoplasmic malesterility system（CMS） in rapeseed in the world[J]. Heilongjiang Agricultural Sciences， 2004（1）： 36-38. （in Chinese） [14]WILLIAMS PH， HEYN FW. The origin and development of cytoplasmic male sterile Chinese cabbage[A]. Chinese Cabbage， Proceeding of the first international symposium[C]. Taiwan： Asian Vegetable Research and Development Center， 1981： 293-300.
[15]ROBERTSON D， EARLE JDP， MUTSCHLER MA. Analysis of organelle genomes in a somatic hybrid derived from cytoplasmic malesterile Brassica oleracea and atrazineresistant B. campestris [J]. Theoretical and Applied Genetics， 1987， 74（3）： 303-309.
[16]ZHU YY， YAO WY， ZHANG SQ， et al. Breeding and utilization of Brassica oleracea Ogura cytoplasmic male sterility line[J]. Acta Agriculturae Shanghai， 1988， 14（2）： 19-24. （in Chinese）
[17]FU TD， YANG GS， YANG XN， et al. Discovery， research and utilization of Brassica napus polima cytoplasmic male sterility[J]. Progress in Natural Science： National key laboratory communication， 1995， 5（3）： 287-293. （in Chinese）
[18]ZHANG DQ， ZHANG FL， XU JB. Characteristics of Chinese Cabbage Cytoplasmic Male Sterile CMS96[J]. Acta Agriculturae BorealiSinica， 2005， 20（1）： 59-62. （in Chinese）
[19]WANG GF， ZHANG LG， LI DX. Restoring and maintaining relationship and molecular identification of cytoplasmic male sterility in Chinese cabbage[J]. Journal of Northwest A & F University： Natural Science Edition， 2014， 42（7）： 183-190. （in Chinese）
[20]JI LZ， SUN DL， SUN LQ. Types and mechanisms of Cruciferae cytoplasmic male sterility[J]. Jiangsu Agricultural Sciences， 2007（3）： 106-110. （in Chinese）
[21]BONHOMME S， BUDAR F， LANCELIN D， et al. Sequence and transcript analysis of the Nco 2.5 Oguraspecific fragment correlation with cytoplasmic male sterility in Brassica hybrids[J]. Mol Gen Genet， 1992， 235： 340-348.
[22]LIU ZY， PETER SO， LONG MH， et al. A PCR assay for rapid discrimination of sterile cytoplasm types in maize[J]. Crop Science， 2002， 42： 566-569.
[23]JING ZG， PEI XL， TANG Z， et al. Molecular identification of Ogu cytoplasmic male sterile and sequence analysis in broccoli （Brassica oleracea var.italica）[J]. Guihaia，2015（02）：231-235-294. （in Chinese）
[24]XU XY， SUN XL， FANG ZY， et al. Clone and analysis of CMS related gene of heading Chinese cabbage [J]. Journal of Northwest A & F University： Natural Science Edition， 2014（12）： 119-125. （in Chinese）
[25]KRISHNASAMY S， MAKAROFF CA. Characterization of the radish mitochondrial orfB locus possible relationship with male sterility in Ogura radish[J]. Curr Genet， 1993， 24（1-2）： 156-163.
[26]YAMAGISHI H， TERACHI T. Intra and interspecific variations in the mitochondrial gene orf138 of Oguratype malesterile cytoplasm from Raphanus sativus and R. raphanistrum[J]. Theor Appl Genet， 2001， 103（5）： 725-732.
[27]GRELON M， BUDAR F， BONHOMME S， et al. Ogura cytoplasmic malesterility （CMS）associated orf138 is translated into a mitochondrial membrane polypeptide in malesterile Brassica cybrids[J]. Mol Gen Genet， 1994， 243（5）： 540-547.
[28]HIESEL R， HAESELER AV， BRENNICKE A. Plant mitochondrial nucleic acid sequences as a tool for phylogenetic analysis[J]. Proc Natl Acad Sci， 1994， 91（2）： 634-638.
Editor： Yingzhi GUANG Proofreader： Xinxiu ZHU