论文部分内容阅读
Analysis of Cloning and Expression Characteristics of Capsicum chinense Jacq. CcMYB Gene
Ziqi ZHAO， Yucen GUO， Wanying ZHANG， Zihan LI， Haoyun SUN， Chunyu ZHANG， Jingying WANG， Qingxun GUO*
College of Plant Science， Jilin University， Changchun 130062， China
Abstract In order to discuss the role of MYB gene in capsaicine synthesis process， one CcMYB gene was cloned from Capsicum chinense Jacq. by RTPCR. Its cDNA has a total length of 1 038 bp， and was speculated to code 345 amino acids， comprising an complete open reading frame. The isoelectric point is 8.57， and the molecular weight is 38.2 KD. The protein is a neutral hydrophobin without transmembrane structure. There are two MYBDNA domains at the N terminal. The fluorescence quantitative PCR results showed that CcMYB gene was expressed in all the root， stem， leaf， flower， placenta and fruit tissue of pepper， and the expression level was the highest in fruit； and CcMYB was expressed in fruit at the highest level at turning stage， and at the second highest level at expansion stage， which accords with the expression profile of pun1 gene in fruit development period. It is speculated that CcMYB gene plays an important role in the regulation of capsaicine synthesis in C. chinense fruit.
Key words Capsicum chinense Jacq.； MYB； Gene cloning； Expression
The biosynthesis of secondary metabolite of plants is mainly controlled by two types of genes， one of which is structural gene， and the other one is regulator gene. The structural gene directly codes various enzymes related to biosynthesis of secondary metabolism， and the regulator gene codes the transcription factor participating in the expression of structural gene.
MYB transcription factor is one of the transcription factors with the largest quantity and the most diverse function in plants， and plays an important role in various life processes. It is now found that MYB transcription factor is of great significance to the whole life process of plants including the construction of cellular morphology[1]， growth and development[2]， and biotic and abiotic response[3-4] and plant primary and secondary metabolisms[5].
The spicy taste of pepper comes from the alkaloids synthesized in fruit placenta， including capsaicine and dihydrocapsaicin. The customarily called capsaicine is the mixture of capsaicinoids， and is unique to pepper fruit. Pepper serves as an important vegetable and flavoring due to its unique spicy taste[6]， and capsaicinoids have the medical and healthcare effects of resisting cancer， easing pain and reducing weight[7-11]. Though the whole genome sequencing of pepper has been already finished[12-13]， and the genes in capsaicine synthesis pathway have been widely studied， few studies have been conducted on the transcription factor participating in the expression and regulation of genes in the synthesis pathway. In this study， one fulllength MYB transcription factor was cloned from C. chinense Jacq.， its bioinformatic analysis was performed， and the expression level of the gene was detected by realtime fluorescence quantification in different tissues of pepper and at different fruit development stages. This study will provide reference for further deep study on the function of the MYB transcription factor and the study on the regulation mechanism of MYB transcription factor to capsaicine synthesis. Material and Methods
Materials
C. chinense was collected from the Practical Teaching Base of the College of Plant Science， Jilin University. Such 6 tissue samples as root， stem， leaf， flower， placenta and fruit， and fruit samples at fruit setting stage， green ripe stage， turning stage and maturation stage， were obtained and cut to small pieces on ice， and rapidly frozen with liquid nitrogen. The samples were preserved in an ultralow temperature refrigerator at -80 ℃.
Cloning and sequencing of CcMYB gene
RTPCR amplification primers were designed according to MYB （EF222025） gene sequence： CcmybF： CATTCTGGCGGGATCCATGG， and CcmybR： GAGAAAGCTTGGATCCATCA. The total DNA of pepper placenta was extracted with RNAiso Reagent. With the total RNA as template， the first cDNA chain was synthesized using the twostep PrimeScripTM 1st Stand Cdna Synthesis Kit （TaKaRa）， and PCR was performed with this chain as template. The amplification was started with predenaturation at 95 ℃ for 5 min， followed by 30 cycles of 94℃ for 10 s， 55℃ for 15 s and 72℃ for 1 min， and completed by extension at 72 ℃ for 10 min. The amplification product was subjected to agarose gel electrophoresis separation and recovery. The recovered product was ligated to pCAMBIA3301 vector using pEASYUniAeamless Clonging and Assembly Kit， and transformed into Escherichia coli DH5α. The identified positive clone was sent to Sangon Biotech （Shanghai） Co.， Ltd. for sequencing.
Sequence analysis of CcMYB gene
The fulllength cDNA sequence of CcMYB obtained through RTPCR was subjected to BLASTP comparison in NCBI， and homology comparison and phylogenetic analysis with DNAMAN.
qRTPCR of CcMYB gene
Primers were designed according to the cDNA sequence of CcMYB gene： qmybF： AGCAGCAACATTATCAACAAC， and qmybR：GCATACATAAGCCAAGTCCTA. The total RNA in the root， stem， leaf， flower， placenta and fruit tissues and total RNA at fruit settling， green ripe， turning and maturation stages were extracted， respectively， and reverse transcription was performed with PrimeScripTM 1st Stand Cdna Synthesis Kit （TaKaRa）. Withactin as reference gene， Realtime RTPCR was performed according to instruction of SYBR Premix Ex TaqTM（TliRNaseH Plus） on a fluorescence quantitative PCR amplifier. Each sample was set with three replicates， and standard deviation was calculated. The calculation formula of data processing was Relative expression level of mRNA=2-△△Ct， wherein △△Ct=（Ct value of the experimental groupReference Ct value of the experimental group）-（Average Ct value of the control group-Average reference Ct value ofthe control group）. Results and Analysis
Cloning and sequence analysis of pepper CcMYB gene
With the cDNA obtained from reverse transcription of extracted C. chinense placenta RNA as template and CcmybF and CcmybR as primers， the target band at about 1 000 bp was obtained through RTPCR （Fig. 1）. The sequencing result showed that the full length of CcMYB gene is 1 038 bp. Analysis was performed in protein sequence analysis function prediction website http：//prosite.expasy.org/. The MYB gene comprises an intact open reading frame， which was speculated to code 345 amino acids （Fig. 3）. The initiation codon is ATG， and the termination codon is TGA. The isoelectric point is 8.57， and the molecular weight is 38.2 KD. The protein is a neutral hydrophobin without transmembrane structure. Subcellular localization prediction was performed on CcMYB gene in http：//www.bioinfo.tsinghua.edu.cn/， and it was found that it might be located in cell nucleus.
Prediction of CcMYB protein domain and phylogenetic analysis
According to analysis and sequence alignment in http：//prosite.expasy.org/， the amino acid sequence of MYB transcription factor had common characteristics with MYB112， MYB106 and MYB44like， i.e.， they all comprise an HTH mybtype domain having 55 amino acids， an HTH mybtype domain having 50 amino acids， and two HTH motif DNA domains having 24 amino acids （Fig. 4）， at the N terminal. It could be speculated that the MYB transcription factor is R2R3MYB transcription factor.
The amino acid sequence of pepper MYB transcription factor was aligned with the MYB transcription factors of various plants using software MEGA5.0， and a phylogenetic tree was built （Fig. 5）. It was found that the amino acid sequence of pepper MYB transcription factor had very high homology with the MYB transcription factors of other plants， with the shortest genetic distance with the transcription factor MYB44like of tomato and Solanum pennellii （0.02）.
Analysis of pepper CcMYB gene expression
The tissue expression analysis showed that CcMYB gene was expressed in all the root， stem， leaf， flower， placenta and fruit tissues of pepper， and the expression level was the highest in fruit （Fig. 6）.
Ziqi ZHAO et al. Analysis of Cloning and Expression Characteristics of Capsicum chinense Jacq. CcMYB Gene
The expression analysis in fruit development period showed that CcMYB was expressed at all the four stages， i.e.， the fruit setting， green ripe， turning and maturation stages. The expression level was the highest at turning stage， the second highest at green ripe stage， and the lowest at maturation stage （Fig. 7）. Discussions
The synthesis and turnover of secondary metabolites often is controlled by multiple ratelimiting enzymes， and it is difficult to determine the ratelimiting steps， so the acquisition of target product at a high yield by regulating the metabolic pathway overall through the regulation of the expression level of transcription factor has a considerable prospect[14-15].
Most capsaicinoids are branched fatty acid amides of vanillylamide， which are obtained from the condensation of vanillylamide and 8methyl6nonenoylCoA synthesized through branchedchain fatty acid pathway under the catalysis of capsaicinoid synthetase （CS）[16-18]. Kim et al.[19] found in C. chinense ‘Habanero’， the sequence SB266 （BF723664） specifically expressed in placenta， which is homologous with acyltransferase （AT） gene， and considered to be capsaicinoid synthetase gene. Stewart et al.[20] finally proved that SB266 is the acyltransferase coded by AT3 in apsaicinoid synthesize pathway， and designated as pun1. The expression of pun1 is related to the pungency of pepper， and the deletion and downregulation expression of pun1 both would cause the decrease of capsaicinoids[21-22].
One R2R3 type CcMYB gene was cloned from C. chinense by RTPCR method， and the expression profile analysis showed that CcMYB gene was expressed at the highest level in fruit， the same as the expression profile of pun1 gene[23]， indicating that this gene has a very important role in the fruit development process of pepper. Meanwhile， the promoter analysis of pun1 gene showed that the promoter comprised cisacting elements of illumination， high temperature and hormone as well as one MYB transcription factor binding site （with TAACTG as core sequence）， indicating that MYB transcription factor might regulate the expression of pun1 gene， thereby regulating the synthesis of capsaicinoids. Therefore， in future， on one hand， whether CcMYB is bound with the promoter of pun1 gene to regulate gene expression could be studied through yeast onehybrid； and on the other hand， more transcription factors participating in regulation of capsaicin synthesis could be isolated through transcriptome sequencing， and combined with biochemical tests， the regulation mechanism of capsaicin biosynthesis by transcription factor could be explored.
References
[1] PEREZRODRIGUEZ M， JAFFE FW， BUTELLI E， et al. Development of three different cell types is associated with the activity of a specific MYB transcription factor in the ventral petal of Antirrhinum majus flowers[J]. Development， 2005， 132（2）： 359-370. [2] HIGGINSON T， LI SF， PARISH RW. At MYB103 regulates tapetum and trichome development in Arabidopsis thaliana[J]. Plant Journal， 2003， 35（2）： 177-192.
[3] HARTMANN U， SAGASSER M， MEHRTENS F， et al. Differential combinatorial interactions of cisacting elements recognized by R2R3MYB， BZIP， and BHLH factors control lightesponsive ang tissuespecific activation of phenylpropanoid biosynthesis genes[J]. Plant Molecular Biology， 2005， 57（2）： 155-171.
[4] JUNG C， SEO JS， HAN SW， et al. Overexpression of At MYB44 enhances stomatal closure to confer abiotic stress tolerance in transgenic Arabidopsis[J]. Plant Physiology， 2008， 146（2）： 623-625.
[5] GOICOECHEA M， LACOMBE E， LEGAY S， et al. EgMYB2，a new transcriptional activator from Eucalyptus xylem， regulates secondary cell wall formation and lignin biosynthesis[J]. Plant Journal， 2005， 43（4）： 553-567.
[6] Bosland P W，Votava E J. Peppers：Vegetable and spice Capsicums. UK：CABI. 2012.
[7] FRAENKEL L， BOGARDUS ST， CONCATO J， et al. Treatment options in knee osteoarthritis：The patients perspective[J]. Archives of Internal Medicine， 2004， 164 （12）： 1299-1304.
[8] LUO XJ， PENG J， LI YJ. Recent advances in the study on capsaicinoids and capsinoids[J]. Eur J Pharmacol， 2011， 650 （1）： 1-7.
[9] LUDY MJ， MOORE GE， MATTES RD. The effects of capsaicin and capsiate on energy balance：Critical review and metaanalyses of studies in humans[J]. Chem Senses， 2012， 37 （2）：103-121.
[10] LAU JK， BROWN KC， DOM AM， et al. Capsaicin induces apoptosis in human small cell lung cancer via the TRPV6 receptor and the calpain pathway[J]. Apoptosis， 2014， 19： 1190-1201.
[11] WHITING S， DERBYSHIRE EJ， TIWARI B. Could capsaicinoids help to support weight management： A systematic review and metaanalysis of energy intake data[J]. Appetite， 2014， 73： 183-188.
[12] KIM S， PARK M， YEOM SI， et al. Genome sequence of the hot pepper provides insights into the evolution of pungency in Capsicum species[J]. Nat Genet， 2014， 46： 270-278.
[13] QIN C， YU C， SHEN Y， et al. Wholegenome sequencing of cultivated and wild peppers provides insights into Capsicum domestication and specialization[J]. P Natl Acad Sci USA， 2014， 111： 5135-5140.
[14] BROUN P. Transcription factors as tools for metabolic engineering in plants[J]. Curr Opin Plant Biol， 2004，7（2）： 202-209.
[15] YAMADA Y， SATO F. Transcription factors in alkaloid biosynthesis[J]. Int Rev Cell Mol Biol， 2013， 305：339-382. [16] AZAGONZALEZ C， NUNEZPALENUIS HG， OCHOAALEJO N. Molecular biology of capsaicinoids biosynthesis in chilipepper （Capsicum spp.）[J]. Plant Cell Rep， 2011， 30：695-706
[17] BENNETT DJ， KIRBY GW. Constitution and biosynthesis of capsaicin[J]. J Chem Soc， 1968， C：442-446.
[18] LEETE E， LOUDEN M. Biosynthesis of capsaicin and dihydrocapsaicin in Capsicum frutescens[J]. J Am Chem Soc， 1968， 90：6837-6841.
[19] KIM M， KIM S， KIM BD. Isolation of cDNA clones differentially accumulated in the placenta of pungent pepper by suppression subtractive hybridization[J]. Mol Cells， 2001， 11：213-219.
[20] STEWART C， KANG BC， LIU K， et al. The pun1 gene for pungency in pepper encodes a putative acyltransferase[J]. Plant J， 2005， 42：675-688.
[21] HAN K， JEONG HJ， SUNG J， et al. Biosynthesis of capsinoid is controlled by the pun1 locus in pepper[J]. Mol Breeding， 2013， 31：537-548.
[22] KOBATA K， SUGIWARA M， MIURA M， et al. Potent production of capsaicinoids and capsinoids by Capsicum peppers[J]. J Agri Food Chem， 2013， 61：11127-11132.
[23] YUWEI DONG， YINGRAN SUN， RAN BI， et al. Cloning and expression of pun1 gene controlling pungency of pepper （Capsicum spp.）[J]. Agricultural Science & Technology， 2016， 17（11）： 2483-2488.
Editor： Yingzhi GUANG Proofreader： Xinxiu ZHU
Ziqi ZHAO， Yucen GUO， Wanying ZHANG， Zihan LI， Haoyun SUN， Chunyu ZHANG， Jingying WANG， Qingxun GUO*
College of Plant Science， Jilin University， Changchun 130062， China
Abstract In order to discuss the role of MYB gene in capsaicine synthesis process， one CcMYB gene was cloned from Capsicum chinense Jacq. by RTPCR. Its cDNA has a total length of 1 038 bp， and was speculated to code 345 amino acids， comprising an complete open reading frame. The isoelectric point is 8.57， and the molecular weight is 38.2 KD. The protein is a neutral hydrophobin without transmembrane structure. There are two MYBDNA domains at the N terminal. The fluorescence quantitative PCR results showed that CcMYB gene was expressed in all the root， stem， leaf， flower， placenta and fruit tissue of pepper， and the expression level was the highest in fruit； and CcMYB was expressed in fruit at the highest level at turning stage， and at the second highest level at expansion stage， which accords with the expression profile of pun1 gene in fruit development period. It is speculated that CcMYB gene plays an important role in the regulation of capsaicine synthesis in C. chinense fruit.
Key words Capsicum chinense Jacq.； MYB； Gene cloning； Expression
The biosynthesis of secondary metabolite of plants is mainly controlled by two types of genes， one of which is structural gene， and the other one is regulator gene. The structural gene directly codes various enzymes related to biosynthesis of secondary metabolism， and the regulator gene codes the transcription factor participating in the expression of structural gene.
MYB transcription factor is one of the transcription factors with the largest quantity and the most diverse function in plants， and plays an important role in various life processes. It is now found that MYB transcription factor is of great significance to the whole life process of plants including the construction of cellular morphology[1]， growth and development[2]， and biotic and abiotic response[3-4] and plant primary and secondary metabolisms[5].
The spicy taste of pepper comes from the alkaloids synthesized in fruit placenta， including capsaicine and dihydrocapsaicin. The customarily called capsaicine is the mixture of capsaicinoids， and is unique to pepper fruit. Pepper serves as an important vegetable and flavoring due to its unique spicy taste[6]， and capsaicinoids have the medical and healthcare effects of resisting cancer， easing pain and reducing weight[7-11]. Though the whole genome sequencing of pepper has been already finished[12-13]， and the genes in capsaicine synthesis pathway have been widely studied， few studies have been conducted on the transcription factor participating in the expression and regulation of genes in the synthesis pathway. In this study， one fulllength MYB transcription factor was cloned from C. chinense Jacq.， its bioinformatic analysis was performed， and the expression level of the gene was detected by realtime fluorescence quantification in different tissues of pepper and at different fruit development stages. This study will provide reference for further deep study on the function of the MYB transcription factor and the study on the regulation mechanism of MYB transcription factor to capsaicine synthesis. Material and Methods
Materials
C. chinense was collected from the Practical Teaching Base of the College of Plant Science， Jilin University. Such 6 tissue samples as root， stem， leaf， flower， placenta and fruit， and fruit samples at fruit setting stage， green ripe stage， turning stage and maturation stage， were obtained and cut to small pieces on ice， and rapidly frozen with liquid nitrogen. The samples were preserved in an ultralow temperature refrigerator at -80 ℃.
Cloning and sequencing of CcMYB gene
RTPCR amplification primers were designed according to MYB （EF222025） gene sequence： CcmybF： CATTCTGGCGGGATCCATGG， and CcmybR： GAGAAAGCTTGGATCCATCA. The total DNA of pepper placenta was extracted with RNAiso Reagent. With the total RNA as template， the first cDNA chain was synthesized using the twostep PrimeScripTM 1st Stand Cdna Synthesis Kit （TaKaRa）， and PCR was performed with this chain as template. The amplification was started with predenaturation at 95 ℃ for 5 min， followed by 30 cycles of 94℃ for 10 s， 55℃ for 15 s and 72℃ for 1 min， and completed by extension at 72 ℃ for 10 min. The amplification product was subjected to agarose gel electrophoresis separation and recovery. The recovered product was ligated to pCAMBIA3301 vector using pEASYUniAeamless Clonging and Assembly Kit， and transformed into Escherichia coli DH5α. The identified positive clone was sent to Sangon Biotech （Shanghai） Co.， Ltd. for sequencing.
Sequence analysis of CcMYB gene
The fulllength cDNA sequence of CcMYB obtained through RTPCR was subjected to BLASTP comparison in NCBI， and homology comparison and phylogenetic analysis with DNAMAN.
qRTPCR of CcMYB gene
Primers were designed according to the cDNA sequence of CcMYB gene： qmybF： AGCAGCAACATTATCAACAAC， and qmybR：GCATACATAAGCCAAGTCCTA. The total RNA in the root， stem， leaf， flower， placenta and fruit tissues and total RNA at fruit settling， green ripe， turning and maturation stages were extracted， respectively， and reverse transcription was performed with PrimeScripTM 1st Stand Cdna Synthesis Kit （TaKaRa）. Withactin as reference gene， Realtime RTPCR was performed according to instruction of SYBR Premix Ex TaqTM（TliRNaseH Plus） on a fluorescence quantitative PCR amplifier. Each sample was set with three replicates， and standard deviation was calculated. The calculation formula of data processing was Relative expression level of mRNA=2-△△Ct， wherein △△Ct=（Ct value of the experimental groupReference Ct value of the experimental group）-（Average Ct value of the control group-Average reference Ct value ofthe control group）. Results and Analysis
Cloning and sequence analysis of pepper CcMYB gene
With the cDNA obtained from reverse transcription of extracted C. chinense placenta RNA as template and CcmybF and CcmybR as primers， the target band at about 1 000 bp was obtained through RTPCR （Fig. 1）. The sequencing result showed that the full length of CcMYB gene is 1 038 bp. Analysis was performed in protein sequence analysis function prediction website http：//prosite.expasy.org/. The MYB gene comprises an intact open reading frame， which was speculated to code 345 amino acids （Fig. 3）. The initiation codon is ATG， and the termination codon is TGA. The isoelectric point is 8.57， and the molecular weight is 38.2 KD. The protein is a neutral hydrophobin without transmembrane structure. Subcellular localization prediction was performed on CcMYB gene in http：//www.bioinfo.tsinghua.edu.cn/， and it was found that it might be located in cell nucleus.
Prediction of CcMYB protein domain and phylogenetic analysis
According to analysis and sequence alignment in http：//prosite.expasy.org/， the amino acid sequence of MYB transcription factor had common characteristics with MYB112， MYB106 and MYB44like， i.e.， they all comprise an HTH mybtype domain having 55 amino acids， an HTH mybtype domain having 50 amino acids， and two HTH motif DNA domains having 24 amino acids （Fig. 4）， at the N terminal. It could be speculated that the MYB transcription factor is R2R3MYB transcription factor.
The amino acid sequence of pepper MYB transcription factor was aligned with the MYB transcription factors of various plants using software MEGA5.0， and a phylogenetic tree was built （Fig. 5）. It was found that the amino acid sequence of pepper MYB transcription factor had very high homology with the MYB transcription factors of other plants， with the shortest genetic distance with the transcription factor MYB44like of tomato and Solanum pennellii （0.02）.
Analysis of pepper CcMYB gene expression
The tissue expression analysis showed that CcMYB gene was expressed in all the root， stem， leaf， flower， placenta and fruit tissues of pepper， and the expression level was the highest in fruit （Fig. 6）.
Ziqi ZHAO et al. Analysis of Cloning and Expression Characteristics of Capsicum chinense Jacq. CcMYB Gene
The expression analysis in fruit development period showed that CcMYB was expressed at all the four stages， i.e.， the fruit setting， green ripe， turning and maturation stages. The expression level was the highest at turning stage， the second highest at green ripe stage， and the lowest at maturation stage （Fig. 7）. Discussions
The synthesis and turnover of secondary metabolites often is controlled by multiple ratelimiting enzymes， and it is difficult to determine the ratelimiting steps， so the acquisition of target product at a high yield by regulating the metabolic pathway overall through the regulation of the expression level of transcription factor has a considerable prospect[14-15].
Most capsaicinoids are branched fatty acid amides of vanillylamide， which are obtained from the condensation of vanillylamide and 8methyl6nonenoylCoA synthesized through branchedchain fatty acid pathway under the catalysis of capsaicinoid synthetase （CS）[16-18]. Kim et al.[19] found in C. chinense ‘Habanero’， the sequence SB266 （BF723664） specifically expressed in placenta， which is homologous with acyltransferase （AT） gene， and considered to be capsaicinoid synthetase gene. Stewart et al.[20] finally proved that SB266 is the acyltransferase coded by AT3 in apsaicinoid synthesize pathway， and designated as pun1. The expression of pun1 is related to the pungency of pepper， and the deletion and downregulation expression of pun1 both would cause the decrease of capsaicinoids[21-22].
One R2R3 type CcMYB gene was cloned from C. chinense by RTPCR method， and the expression profile analysis showed that CcMYB gene was expressed at the highest level in fruit， the same as the expression profile of pun1 gene[23]， indicating that this gene has a very important role in the fruit development process of pepper. Meanwhile， the promoter analysis of pun1 gene showed that the promoter comprised cisacting elements of illumination， high temperature and hormone as well as one MYB transcription factor binding site （with TAACTG as core sequence）， indicating that MYB transcription factor might regulate the expression of pun1 gene， thereby regulating the synthesis of capsaicinoids. Therefore， in future， on one hand， whether CcMYB is bound with the promoter of pun1 gene to regulate gene expression could be studied through yeast onehybrid； and on the other hand， more transcription factors participating in regulation of capsaicin synthesis could be isolated through transcriptome sequencing， and combined with biochemical tests， the regulation mechanism of capsaicin biosynthesis by transcription factor could be explored.
References
[1] PEREZRODRIGUEZ M， JAFFE FW， BUTELLI E， et al. Development of three different cell types is associated with the activity of a specific MYB transcription factor in the ventral petal of Antirrhinum majus flowers[J]. Development， 2005， 132（2）： 359-370. [2] HIGGINSON T， LI SF， PARISH RW. At MYB103 regulates tapetum and trichome development in Arabidopsis thaliana[J]. Plant Journal， 2003， 35（2）： 177-192.
[3] HARTMANN U， SAGASSER M， MEHRTENS F， et al. Differential combinatorial interactions of cisacting elements recognized by R2R3MYB， BZIP， and BHLH factors control lightesponsive ang tissuespecific activation of phenylpropanoid biosynthesis genes[J]. Plant Molecular Biology， 2005， 57（2）： 155-171.
[4] JUNG C， SEO JS， HAN SW， et al. Overexpression of At MYB44 enhances stomatal closure to confer abiotic stress tolerance in transgenic Arabidopsis[J]. Plant Physiology， 2008， 146（2）： 623-625.
[5] GOICOECHEA M， LACOMBE E， LEGAY S， et al. EgMYB2，a new transcriptional activator from Eucalyptus xylem， regulates secondary cell wall formation and lignin biosynthesis[J]. Plant Journal， 2005， 43（4）： 553-567.
[6] Bosland P W，Votava E J. Peppers：Vegetable and spice Capsicums. UK：CABI. 2012.
[7] FRAENKEL L， BOGARDUS ST， CONCATO J， et al. Treatment options in knee osteoarthritis：The patients perspective[J]. Archives of Internal Medicine， 2004， 164 （12）： 1299-1304.
[8] LUO XJ， PENG J， LI YJ. Recent advances in the study on capsaicinoids and capsinoids[J]. Eur J Pharmacol， 2011， 650 （1）： 1-7.
[9] LUDY MJ， MOORE GE， MATTES RD. The effects of capsaicin and capsiate on energy balance：Critical review and metaanalyses of studies in humans[J]. Chem Senses， 2012， 37 （2）：103-121.
[10] LAU JK， BROWN KC， DOM AM， et al. Capsaicin induces apoptosis in human small cell lung cancer via the TRPV6 receptor and the calpain pathway[J]. Apoptosis， 2014， 19： 1190-1201.
[11] WHITING S， DERBYSHIRE EJ， TIWARI B. Could capsaicinoids help to support weight management： A systematic review and metaanalysis of energy intake data[J]. Appetite， 2014， 73： 183-188.
[12] KIM S， PARK M， YEOM SI， et al. Genome sequence of the hot pepper provides insights into the evolution of pungency in Capsicum species[J]. Nat Genet， 2014， 46： 270-278.
[13] QIN C， YU C， SHEN Y， et al. Wholegenome sequencing of cultivated and wild peppers provides insights into Capsicum domestication and specialization[J]. P Natl Acad Sci USA， 2014， 111： 5135-5140.
[14] BROUN P. Transcription factors as tools for metabolic engineering in plants[J]. Curr Opin Plant Biol， 2004，7（2）： 202-209.
[15] YAMADA Y， SATO F. Transcription factors in alkaloid biosynthesis[J]. Int Rev Cell Mol Biol， 2013， 305：339-382. [16] AZAGONZALEZ C， NUNEZPALENUIS HG， OCHOAALEJO N. Molecular biology of capsaicinoids biosynthesis in chilipepper （Capsicum spp.）[J]. Plant Cell Rep， 2011， 30：695-706
[17] BENNETT DJ， KIRBY GW. Constitution and biosynthesis of capsaicin[J]. J Chem Soc， 1968， C：442-446.
[18] LEETE E， LOUDEN M. Biosynthesis of capsaicin and dihydrocapsaicin in Capsicum frutescens[J]. J Am Chem Soc， 1968， 90：6837-6841.
[19] KIM M， KIM S， KIM BD. Isolation of cDNA clones differentially accumulated in the placenta of pungent pepper by suppression subtractive hybridization[J]. Mol Cells， 2001， 11：213-219.
[20] STEWART C， KANG BC， LIU K， et al. The pun1 gene for pungency in pepper encodes a putative acyltransferase[J]. Plant J， 2005， 42：675-688.
[21] HAN K， JEONG HJ， SUNG J， et al. Biosynthesis of capsinoid is controlled by the pun1 locus in pepper[J]. Mol Breeding， 2013， 31：537-548.
[22] KOBATA K， SUGIWARA M， MIURA M， et al. Potent production of capsaicinoids and capsinoids by Capsicum peppers[J]. J Agri Food Chem， 2013， 61：11127-11132.
[23] YUWEI DONG， YINGRAN SUN， RAN BI， et al. Cloning and expression of pun1 gene controlling pungency of pepper （Capsicum spp.）[J]. Agricultural Science & Technology， 2016， 17（11）： 2483-2488.
Editor： Yingzhi GUANG Proofreader： Xinxiu ZHU